University of Guilan Animal Production Research 2252-0872 15 1 2026 03 21 Transcriptomic analysis of the intestinal tissue of male broiler chicks to identify key hub genes and miRNA associated with feed efficiency Transcriptomic analysis of the intestinal tissue of male broiler chicks to identify key hub genes and miRNA associated with feed efficiency 1 23 9418 10.22124/ar.2026.31889.1927 FA M. Montazery Department of Animal Science, Faculty of Agricultural Sciences, University of Guilan, Rasht, Iran S. Z. Mirhoseini Department of Animal Science, Faculty of Agricultural Sciences, University of Guilan, Rasht, Iran Sh. Ghovvati Department of Animal Science, Faculty of Agricultural Sciences, University of Guilan, Rasht, Iran M. Khansefid Agriculture Victoria Research Division, AgriBio Centre for AgriBioscience, 5 Ring Road, Bundoora, Victoria 3083, Australia School of Applied Systems Biology, La Trobe University, Bundoora, Victoria 3083, Australia Journal Article 2025 10 05 Introduction: Integrating RNA-seq and microarray data provides an advanced statistical approach to combine heterogeneous transcriptomic datasets. This approach controls technical variations and can model individual variance, thereby improving the sensitivity for identifying differentially expressed genes and enabling integrated biological pathway analysis. In the livestock and poultry breeding programs, improving feed efficiency is a key goal due to its significant economic benefits. Defined as the ratio between feed intake and weight gain or production, feed efficiency is influenced by a combination of genetic, physiological, nutritional, and environmental factors. Understanding the molecular mechanisms underlying feed efficiency variation can lead to targeted breeding strategies in selective breeding. Given the critical role of the intestine as the primary site of feed digestion and absorption, in this study, transcriptomic data from different platforms was integrated to identify genes, regulatory microRNAs, and shared biological pathways associated with feed efficiency in the duodenum of broilers. The findings support the coordinated roles of energy metabolism and gene expression regulation in intestinal feed efficiency and provide a foundation for the development of molecular markers for breeding applications. Materials and methods: RNA-seq and microarray datasets were integrated based on the shared Ensembl ID using the BASE package in R. Batch effects across datasets were corrected using ComBat, followed by cross-platform quantile normalization. Low-expression genes were filtered using the 25th percentile threshold, and differential gene expression analysis was performed with the limma package in R. The genes with ∣logFC∣>1.5| and P<0.05 were considered significant. Gene ontology and pathway enrichment analyses were conducted using DAVID and KEGG. Protein–protein interaction networks were constructed using STRING and visualized in Cytoscape, with hub genes identified using the MCODE and CytoHubba plugins. Additionally, miRNA–mRNA regulatory networks were generated based on predictions from TargetScan and miRDB. Results and discussion: Comparison of the gene expression profile between groups with low and high feed efficiency revealed a total of 918 significantly differentially expressed genes, including 563 downregulated and 355 upregulated genes. Pathway enrichment analysis highlighted the involvement of energy metabolism, lipid metabolism, and immune-related processes in feed efficiency. The phagosome pathway was significantly enriched, with increased expression of IL16 in the group with high feed efficiency, suggesting higher immune and inflammatory activity. In contrast, the tricarboxylic acid (TCA) cycle was among the most enriched pathways, showing higher expression levels in the group with high feed efficiency. Given the high ATP demand of the intestine for digestion, nutrient absorption, and rapid epithelial renewal, enhanced TCA cycle activity reflects more efficient energy production in the group with higher feed efficiency. Furthermore, increased expression of glutathione S-transferase family genes (GSTA2, GSTA3, GSTM1, and GSTM2) in the group with high feed efficiency indicates an improved antioxidant defense system, which may contribute to reduced oxidative stress and enhanced metabolic efficiency. The key genes involved in fatty acid metabolism (ACADL, ACSL5, EHHADH, and FABP1) were enriched in the PPAR signaling pathway, underscoring their roles in lipid oxidation and energy homeostasis. The identification of ACO1 suggests that regulation of energy metabolism extends beyond the TCA cycle and is linked to nitrogen metabolism and protein synthesis. Moreover, ribosomal protein genes, particularly RPS6, along with hub genes associated with oxidative phosphorylation (NDUFAB1, NDUFA12, NDUFA9, NDUFS6, UQCRQ, and COX7C), emphasize the major role of mitochondrial function and the mTOR–ribosome axis in enhancing ATP production efficiency and lean tissue growth. The robustness of these key genes was further supported by ROC analysis, with all identified biomarkers exhibiting AUC values greater than 0.8, highlighting their potential as molecular indicators of feed efficiency. Conclusions: Overall, the findings of this study indicate that feed efficiency is largely influenced by the coordinated regulation of intestinal energy metabolism, mitochondrial function, and antioxidant defense systems. Higher feed efficiency was correlated with an increased activity of the TCA cycle, oxidative phosphorylation, fatty acid oxidation, and the mTOR–ribosome axis, leading to more efficient ATP production and protein synthesis. Concurrently, the upregulation of glutathione S-transferase–related genes in the group with high feed efficiency reflects improved redox balance and reduced metabolic burden, whereas higher immune-related pathway activity in the group with low feed efficiency may indicate greater energy allocation towards inflammatory processes. Collectively, these results indicate mitochondrial integrity and metabolic flexibility as key physiological mechanisms underlying feed efficiency and highlight the identified genes as promising molecular biomarkers in selective breeding and nutrition management. Introduction: Integrating RNA-seq and microarray data provides an advanced statistical approach to combine heterogeneous transcriptomic datasets. This approach controls technical variations and can model individual variance, thereby improving the sensitivity for identifying differentially expressed genes and enabling integrated biological pathway analysis. In the livestock and poultry breeding programs, improving feed efficiency is a key goal due to its significant economic benefits. Defined as the ratio between feed intake and weight gain or production, feed efficiency is influenced by a combination of genetic, physiological, nutritional, and environmental factors. Understanding the molecular mechanisms underlying feed efficiency variation can lead to targeted breeding strategies in selective breeding. Given the critical role of the intestine as the primary site of feed digestion and absorption, in this study, transcriptomic data from different platforms was integrated to identify genes, regulatory microRNAs, and shared biological pathways associated with feed efficiency in the duodenum of broilers. The findings support the coordinated roles of energy metabolism and gene expression regulation in intestinal feed efficiency and provide a foundation for the development of molecular markers for breeding applications. Materials and methods: RNA-seq and microarray datasets were integrated based on the shared Ensembl ID using the BASE package in R. Batch effects across datasets were corrected using ComBat, followed by cross-platform quantile normalization. Low-expression genes were filtered using the 25th percentile threshold, and differential gene expression analysis was performed with the limma package in R. The genes with ∣logFC∣>1.5| and P<0.05 were considered significant. Gene ontology and pathway enrichment analyses were conducted using DAVID and KEGG. Protein–protein interaction networks were constructed using STRING and visualized in Cytoscape, with hub genes identified using the MCODE and CytoHubba plugins. Additionally, miRNA–mRNA regulatory networks were generated based on predictions from TargetScan and miRDB. Results and discussion: Comparison of the gene expression profile between groups with low and high feed efficiency revealed a total of 918 significantly differentially expressed genes, including 563 downregulated and 355 upregulated genes. Pathway enrichment analysis highlighted the involvement of energy metabolism, lipid metabolism, and immune-related processes in feed efficiency. The phagosome pathway was significantly enriched, with increased expression of IL16 in the group with high feed efficiency, suggesting higher immune and inflammatory activity. In contrast, the tricarboxylic acid (TCA) cycle was among the most enriched pathways, showing higher expression levels in the group with high feed efficiency. Given the high ATP demand of the intestine for digestion, nutrient absorption, and rapid epithelial renewal, enhanced TCA cycle activity reflects more efficient energy production in the group with higher feed efficiency. Furthermore, increased expression of glutathione S-transferase family genes (GSTA2, GSTA3, GSTM1, and GSTM2) in the group with high feed efficiency indicates an improved antioxidant defense system, which may contribute to reduced oxidative stress and enhanced metabolic efficiency. The key genes involved in fatty acid metabolism (ACADL, ACSL5, EHHADH, and FABP1) were enriched in the PPAR signaling pathway, underscoring their roles in lipid oxidation and energy homeostasis. The identification of ACO1 suggests that regulation of energy metabolism extends beyond the TCA cycle and is linked to nitrogen metabolism and protein synthesis. Moreover, ribosomal protein genes, particularly RPS6, along with hub genes associated with oxidative phosphorylation (NDUFAB1, NDUFA12, NDUFA9, NDUFS6, UQCRQ, and COX7C), emphasize the major role of mitochondrial function and the mTOR–ribosome axis in enhancing ATP production efficiency and lean tissue growth. The robustness of these key genes was further supported by ROC analysis, with all identified biomarkers exhibiting AUC values greater than 0.8, highlighting their potential as molecular indicators of feed efficiency. Conclusions: Overall, the findings of this study indicate that feed efficiency is largely influenced by the coordinated regulation of intestinal energy metabolism, mitochondrial function, and antioxidant defense systems. Higher feed efficiency was correlated with an increased activity of the TCA cycle, oxidative phosphorylation, fatty acid oxidation, and the mTOR–ribosome axis, leading to more efficient ATP production and protein synthesis. Concurrently, the upregulation of glutathione S-transferase–related genes in the group with high feed efficiency reflects improved redox balance and reduced metabolic burden, whereas higher immune-related pathway activity in the group with low feed efficiency may indicate greater energy allocation towards inflammatory processes. Collectively, these results indicate mitochondrial integrity and metabolic flexibility as key physiological mechanisms underlying feed efficiency and highlight the identified genes as promising molecular biomarkers in selective breeding and nutrition management.

https://ar.guilan.ac.ir/article_9418_615a3b7713463cf7cac7b15d2d7faeec.pdf

University of Guilan Animal Production Research 2252-0872 15 1 2026 03 21 Predictive analysis of miRNA interactions with RPS28 and RPL31 ribosomal genes and their role in the immune response of chickens to avian influenza infection Predictive analysis of miRNA interactions with RPS28 and RPL31 ribosomal genes and their role in the immune response of chickens to avian influenza infection 25 43 9102 10.22124/ar.2025.31279.1912 FA J. Shirani Shamsabadi Department of Animal Science, College of Agriculture, Isfahan University of Technology, Isfahan, Iran M. Ghaderi-Zefrehei Department of Animal Science, Agricultural Faculty, Yasouj University, Yasouj, Iran Journal Article 2025 07 27 Introduction: MicroRNAs (miRNAs) are short non-coding RNA molecules, typically 18–24 nucleotides in length, that regulate gene expression post-transcriptionally by binding to complementary sequences in target mRNAs. This interaction can lead to mRNA degradation or translational repression. miRNAs play essential roles in various biological processes, including cell growth, differentiation, apoptosis, metabolism, and immune responses. In poultry, miRNAs are particularly important in modulating immune responses to viral infections such as avian influenza. These molecules can either enhance host defense mechanisms or be exploited by viruses to facilitate infection. The discovery of miRNAs has revolutionized our understanding of gene regulatory networks and opened new avenues for research in genomics, bioinformatics, and infectious disease biology. This study aimed to identify and analyze key miRNAs involved in the immune response of chickens to avian influenza, focusing on their predicted interactions with two ribosomal genes of RPS28 and RPL31. Materials and methods: Two ribosomal genes (RPS28 and RPL31) were selected based on prior transcriptomic analysis using microarray data (GSE96837) from the GEO/NCBI database. The reference genome Gallus gallus GRCg6a (GenBank: GCA_000002315.5) was used for bioinformatic analyses. The tools4miRs platform was employed to predict miRNA–mRNA interactions, integrating 10 algorithms including TargetSpy, miRanda, RNAhybrid, TargetScan, DIANA-microT, MicroTar, miRMap, PITA, RNA22, and Guugle. These tools assess binding potential based on parameters such as free energy, seed sequence complementarity, and evolutionary conservation. Identified miRNAs were cross-referenced with the miRBase database to confirm their annotation status. Results and discussion: Eleven miRNAs (gga-miR-1593, gga-miR-1609, gga-miR-194, gga-miR-214, gga-miR-3532-3p, gga-miR-6567-3p, gga-miR-6579-5p, gga-miR-6612-5p, gga-miR-6642-3p, gga-miR-7477-5p, and gga-miR-708-5p) were analyzed for their interactions with RPS28 and RPL31. For RPL31, gga-miR-6642-3p and gga-miR-3532-3p emerged as the strongest candidates, supported by four independent tools and possessing 15 and 12 binding sites, respectively. For RPS28, gga-miR-6567-3p, gga-miR-6642-3p, gga-miR-7477-5p, and gga-miR-6579-5p were confirmed by five tools and had 8-10 binding sites, indicating strong regulatory potential. Comparative analysis revealed that gga-miR-6642-3p had high regulatory potential for both genes, although binding patterns varied due to gene-specific sequence and structural differences. These findings suggest specificity and overlap in miRNA function across biological pathways. Experimental validation is essential to confirm these bioinformatic predictions. Ribosomal gene expression changes have been linked to immune responses and stress tolerance in poultry. During viral outbreaks such as avian influenza, ribosomal gene expression patterns shift, influencing inflammatory and immune responses. Understanding these changes can aid in vaccine development and disease control strategies. Ribosomal genes are vital for protein synthesis and cellular function, directly impacting poultry growth, development, and health. Located in nucleolus organizer regions (NORs), these genes vary in copy number across poultry lines, correlating with phenotypic traits and breeding responses. For example, white and brown laying hens exhibit different ribosomal gene profiles, affecting protein synthesis capacity and physiological development. RPL3L has been identified as a key gene associated with muscle growth and body weight, influencing skeletal muscle proliferation and differentiation. Mutations in this gene may serve as molecular markers for breeding programs. Ribosomal genes also play roles in immune responses. Their expression changes during infections such as avian influenza, offering insights into disease mechanisms and potential therapeutic targets. Microbiota profiling using 16S rRNA sequencing has furthered our understanding of gut health and its impact on poultry nutrition and productivity. Modern technologies like RNA-Seq and bioinformatic network analysis have enhanced our ability to study ribosomal gene function across tissues and developmental stages, contributing to improved breeding and production management. Conclusions: This comprehensive in silico analysis highlights the regulatory potential of specific miRNAs in the immune response of chickens to avian influenza. miRNAs such as gga-miR-214, gga-miR-194, gga-miR-7477-5p, and gga-miR-6642-3p demonstrate strong interactions with RPS28 and RPL31 ribosomal genes, suggesting roles in antiviral defense and cellular regulation. These findings provide a foundation for future experimental validation and may contribute to the development of miRNA-based strategies for enhancing disease resistance and improving poultry health. The integration of network analysis and bioinformatics offers a powerful model for studying miRNA roles in other diseases and species, paving the way for innovative approaches in veterinary medicine and bioelectronics. Further functional studies are recommended to evaluate the efficacy of epigenetic interventions targeting these miRNAs in managing avian influenza infections. Introduction: MicroRNAs (miRNAs) are short non-coding RNA molecules, typically 18–24 nucleotides in length, that regulate gene expression post-transcriptionally by binding to complementary sequences in target mRNAs. This interaction can lead to mRNA degradation or translational repression. miRNAs play essential roles in various biological processes, including cell growth, differentiation, apoptosis, metabolism, and immune responses. In poultry, miRNAs are particularly important in modulating immune responses to viral infections such as avian influenza. These molecules can either enhance host defense mechanisms or be exploited by viruses to facilitate infection. The discovery of miRNAs has revolutionized our understanding of gene regulatory networks and opened new avenues for research in genomics, bioinformatics, and infectious disease biology. This study aimed to identify and analyze key miRNAs involved in the immune response of chickens to avian influenza, focusing on their predicted interactions with two ribosomal genes of RPS28 and RPL31. Materials and methods: Two ribosomal genes (RPS28 and RPL31) were selected based on prior transcriptomic analysis using microarray data (GSE96837) from the GEO/NCBI database. The reference genome Gallus gallus GRCg6a (GenBank: GCA_000002315.5) was used for bioinformatic analyses. The tools4miRs platform was employed to predict miRNA–mRNA interactions, integrating 10 algorithms including TargetSpy, miRanda, RNAhybrid, TargetScan, DIANA-microT, MicroTar, miRMap, PITA, RNA22, and Guugle. These tools assess binding potential based on parameters such as free energy, seed sequence complementarity, and evolutionary conservation. Identified miRNAs were cross-referenced with the miRBase database to confirm their annotation status. Results and discussion: Eleven miRNAs (gga-miR-1593, gga-miR-1609, gga-miR-194, gga-miR-214, gga-miR-3532-3p, gga-miR-6567-3p, gga-miR-6579-5p, gga-miR-6612-5p, gga-miR-6642-3p, gga-miR-7477-5p, and gga-miR-708-5p) were analyzed for their interactions with RPS28 and RPL31. For RPL31, gga-miR-6642-3p and gga-miR-3532-3p emerged as the strongest candidates, supported by four independent tools and possessing 15 and 12 binding sites, respectively. For RPS28, gga-miR-6567-3p, gga-miR-6642-3p, gga-miR-7477-5p, and gga-miR-6579-5p were confirmed by five tools and had 8-10 binding sites, indicating strong regulatory potential. Comparative analysis revealed that gga-miR-6642-3p had high regulatory potential for both genes, although binding patterns varied due to gene-specific sequence and structural differences. These findings suggest specificity and overlap in miRNA function across biological pathways. Experimental validation is essential to confirm these bioinformatic predictions. Ribosomal gene expression changes have been linked to immune responses and stress tolerance in poultry. During viral outbreaks such as avian influenza, ribosomal gene expression patterns shift, influencing inflammatory and immune responses. Understanding these changes can aid in vaccine development and disease control strategies. Ribosomal genes are vital for protein synthesis and cellular function, directly impacting poultry growth, development, and health. Located in nucleolus organizer regions (NORs), these genes vary in copy number across poultry lines, correlating with phenotypic traits and breeding responses. For example, white and brown laying hens exhibit different ribosomal gene profiles, affecting protein synthesis capacity and physiological development. RPL3L has been identified as a key gene associated with muscle growth and body weight, influencing skeletal muscle proliferation and differentiation. Mutations in this gene may serve as molecular markers for breeding programs. Ribosomal genes also play roles in immune responses. Their expression changes during infections such as avian influenza, offering insights into disease mechanisms and potential therapeutic targets. Microbiota profiling using 16S rRNA sequencing has furthered our understanding of gut health and its impact on poultry nutrition and productivity. Modern technologies like RNA-Seq and bioinformatic network analysis have enhanced our ability to study ribosomal gene function across tissues and developmental stages, contributing to improved breeding and production management. Conclusions: This comprehensive in silico analysis highlights the regulatory potential of specific miRNAs in the immune response of chickens to avian influenza. miRNAs such as gga-miR-214, gga-miR-194, gga-miR-7477-5p, and gga-miR-6642-3p demonstrate strong interactions with RPS28 and RPL31 ribosomal genes, suggesting roles in antiviral defense and cellular regulation. These findings provide a foundation for future experimental validation and may contribute to the development of miRNA-based strategies for enhancing disease resistance and improving poultry health. The integration of network analysis and bioinformatics offers a powerful model for studying miRNA roles in other diseases and species, paving the way for innovative approaches in veterinary medicine and bioelectronics. Further functional studies are recommended to evaluate the efficacy of epigenetic interventions targeting these miRNAs in managing avian influenza infections.

https://ar.guilan.ac.ir/article_9102_d5f9160be5817de95811d81baa2ef17a.pdf

University of Guilan Animal Production Research 2252-0872 15 1 2026 03 21 Polymorphisms of THRSP gene exon 2 and their associations with production and reproductive traits in Markhoz goats Polymorphisms of THRSP gene exon 2 and their associations with production and reproductive traits in Markhoz goats 45 55 9025 10.22124/ar.2025.31041.1907 FA A. Moradalian Department of Animal Science, Faculty of Agriculture, Bu-Ali Sina University, Hamedan, Iran P. Zamani Department of Animal Science, Faculty of Agriculture, Bu-Ali Sina University, Hamedan, Iran 0000-0002-1051-2259 M. Ghasemi Department of Animal Science, Faculty of Agriculture, Bu-Ali Sina University, Hamedan, Iran R. Abdoli Iran Silk Research Centre, Agricultural Research, Education and Extension Organization (AREEO), Guilan, Iran 0000-0003-0792-1980 Journal Article 2025 06 30 Introduction: Quantitative traits are mainly controlled by many genes with additive effects. However, some genes may have a significant impact on the genetic variation of traits, which are so called major genes and alongside genetic markers, and can be utilized in selection programs for economically important traits. The thyroid hormone responsive gene (THRSP) is a protein-coding gene that is predominantly expressed in mammary, adipose, and liver tissues, and its role in lipid metabolism has been demonstrated in some previous studies. Therefore, its expression may influence various performance and reproductive traits in farm animals. In a previous study, polymorphisms of the THRSP gene exon 1 had significant associations with reproductive traits in Markhoz goats. This study was conducted to investigate polymorphisms in exon 2 of the THRSP gene and their association with production and reproductive traits in Markhoz goats, as an endangered breed. Materials and methods: Blood samples were collected from 146 female Markhoz goats at the Markhoz Goat Research Station in Kurdistan Province, Iran. Polymerase chain reactions (PCR) were performed to amplify two fragments of 306 and 414 base pairs from exon 2 of this gene, using two pairs of specific primers as follows: The 306 bp fragment: 5' GTTCACACTCCTATGCCTA 3' (Forward) and 5' TTTATGGCTCATCAAGTCCGA 3' (Reverse); the 414 bp fragment: 5' TCGCTCCTCTCACTAGCTTG 3' (Forward) and 5' GTCTCTGCTCAATAGGCAT 3' (Reverse). Polymorphisms in the amplified fragments were evaluated using single-strand conformation polymorphism (SSCP) analysis and DNA sequencing. The obtained sequences were compared with the goat reference genome (ARS1: GCF_001704415.1). Allelic and genotypic frequencies were calculated using the counting method, and differences between the observed genotypic frequencies and those expected under Hardy-Weinberg equilibrium were assessed using the chi-square test. The association between the observed genotypes and body weights at different ages was analyzed using a general linear model (GLM), while the association between litter size per lambing and the observed genotypes was evaluated using the non-parametric Wilcoxon test. Results and discussion: In the SSCP analysis of the studied fragments, two distinct patterns were observed for the 414 bp fragment and three distinct patterns were observed for the 306 bp fragment. The sequencing results revealed three single-nucleotide polymorphisms (SNPs) including CHR 29. g.17430527 C>T, CHR 29. g.17430290 G>A, and CHR 29. g.17430307 C>T. The polymorphisms identified in this study have not been previously reported in other goat populations and therefore, can be considered as novel mutations of this gene in goats. The analysis of the predicted amino acid sequences and their comparison with the polypeptide sequence encoded by the reference sequence XM_005699494.3 in GenBank and the goat THRSP sequence in the Ensembl database (ENSCHIG00040005633) revealed that, although the mutations identified in this study were located in exon 2 of THRSP, none of them were present in the final polypeptide product of this gene (sequence XP_005699551.2 in the NCBI database). None of the detected polymorphisms had a significant association with body weight or litter size traits. Non-significant effects of these mutations on the studied production and reproductive traits is likely due to absence of their influence on the amino acid sequence of the final polypeptide product. The observed genotype frequencies at CHR 29. g.17430527 C>T and CHR 29. g.17430290 G>A loci deviated from the Hardy-Weinberg equilibrium. Such deviations may be attributed to sampling effects or genetic drift resulting from the small population size of Markhoz goats. However, it is also possible that these mutations influence RNA splicing process or gene expression, which requires further investigation. Conclusions: In this study, three single-nucleotide polymorphisms of CHR 29. g.17430527 C>T, CHR 29. g.17430290 G>A and CHR 29. g.17430307 C>T. were identified in exon 2 of the THRSP gene in Markhoz goats, none of which were significantly associated with body weight or litter size traits. It seems that further studies on other major genes in this breed are necessary to identify polymorphisms associated with production and reproductive traits to identify potential markers to use in selection programs. Moreover, it is recommended that similar studies should be conducted on other breeds with larger effective population sizes. Introduction: Quantitative traits are mainly controlled by many genes with additive effects. However, some genes may have a significant impact on the genetic variation of traits, which are so called major genes and alongside genetic markers, and can be utilized in selection programs for economically important traits. The thyroid hormone responsive gene (THRSP) is a protein-coding gene that is predominantly expressed in mammary, adipose, and liver tissues, and its role in lipid metabolism has been demonstrated in some previous studies. Therefore, its expression may influence various performance and reproductive traits in farm animals. In a previous study, polymorphisms of the THRSP gene exon 1 had significant associations with reproductive traits in Markhoz goats. This study was conducted to investigate polymorphisms in exon 2 of the THRSP gene and their association with production and reproductive traits in Markhoz goats, as an endangered breed. Materials and methods: Blood samples were collected from 146 female Markhoz goats at the Markhoz Goat Research Station in Kurdistan Province, Iran. Polymerase chain reactions (PCR) were performed to amplify two fragments of 306 and 414 base pairs from exon 2 of this gene, using two pairs of specific primers as follows: The 306 bp fragment: 5' GTTCACACTCCTATGCCTA 3' (Forward) and 5' TTTATGGCTCATCAAGTCCGA 3' (Reverse); the 414 bp fragment: 5' TCGCTCCTCTCACTAGCTTG 3' (Forward) and 5' GTCTCTGCTCAATAGGCAT 3' (Reverse). Polymorphisms in the amplified fragments were evaluated using single-strand conformation polymorphism (SSCP) analysis and DNA sequencing. The obtained sequences were compared with the goat reference genome (ARS1: GCF_001704415.1). Allelic and genotypic frequencies were calculated using the counting method, and differences between the observed genotypic frequencies and those expected under Hardy-Weinberg equilibrium were assessed using the chi-square test. The association between the observed genotypes and body weights at different ages was analyzed using a general linear model (GLM), while the association between litter size per lambing and the observed genotypes was evaluated using the non-parametric Wilcoxon test. Results and discussion: In the SSCP analysis of the studied fragments, two distinct patterns were observed for the 414 bp fragment and three distinct patterns were observed for the 306 bp fragment. The sequencing results revealed three single-nucleotide polymorphisms (SNPs) including CHR 29. g.17430527 C>T, CHR 29. g.17430290 G>A, and CHR 29. g.17430307 C>T. The polymorphisms identified in this study have not been previously reported in other goat populations and therefore, can be considered as novel mutations of this gene in goats. The analysis of the predicted amino acid sequences and their comparison with the polypeptide sequence encoded by the reference sequence XM_005699494.3 in GenBank and the goat THRSP sequence in the Ensembl database (ENSCHIG00040005633) revealed that, although the mutations identified in this study were located in exon 2 of THRSP, none of them were present in the final polypeptide product of this gene (sequence XP_005699551.2 in the NCBI database). None of the detected polymorphisms had a significant association with body weight or litter size traits. Non-significant effects of these mutations on the studied production and reproductive traits is likely due to absence of their influence on the amino acid sequence of the final polypeptide product. The observed genotype frequencies at CHR 29. g.17430527 C>T and CHR 29. g.17430290 G>A loci deviated from the Hardy-Weinberg equilibrium. Such deviations may be attributed to sampling effects or genetic drift resulting from the small population size of Markhoz goats. However, it is also possible that these mutations influence RNA splicing process or gene expression, which requires further investigation. Conclusions: In this study, three single-nucleotide polymorphisms of CHR 29. g.17430527 C>T, CHR 29. g.17430290 G>A and CHR 29. g.17430307 C>T. were identified in exon 2 of the THRSP gene in Markhoz goats, none of which were significantly associated with body weight or litter size traits. It seems that further studies on other major genes in this breed are necessary to identify polymorphisms associated with production and reproductive traits to identify potential markers to use in selection programs. Moreover, it is recommended that similar studies should be conducted on other breeds with larger effective population sizes.

https://ar.guilan.ac.ir/article_9025_764444afc45acee99f304cd6ed27e9ab.pdf

University of Guilan Animal Production Research 2252-0872 15 1 2026 03 21 Evaluation of growth performance, blood biochemical indices, and jejunum morphology in broiler chickens fed with hydroalcoholic extract of tarragon and vitamin E Evaluation of growth performance, blood biochemical indices, and jejunum morphology in broiler chickens fed with hydroalcoholic extract of tarragon and vitamin E 57 70 9229 10.22124/ar.2025.31251.1910 FA M. Ahani Department of Animal Science, College of Agriculture, University of Birjand, Birjand, Iran S. J. Hosseini-Vashan Department of Animal Science, College of Agriculture, University of Birjand, Birjand, Iran N. Afzali Department of Animal Science, College of Agriculture, University of Birjand, Birjand, Iran Journal Article 2025 07 23 Introduction: Production of high-quality protein and white meat products is of paramount importance. To achieve this, the researchers and producers have focused on utilizing growth-promoting compounds and immune system enhancers. These include antibiotics, acidifiers, probiotics, and herbal extracts compounds, which influence gastrointestinal motility, digestive secretions, and transit rate of digesta, gut microbial populations, and intestinal epithelial cell proliferation. Such mechanisms enhance digestive efficiency, nutrient absorption, and ultimately improve growth performance and immune responses in poultry. Among bioactive herbal compounds, tarragon (Artemisia dracunculus) is notable for its rich content of phenolic compounds, carotenoids, coumarins, tannins, and vitamins. Therefore, an experiment was designed to evaluate the effects of hydroalcoholic tarragon extract and vitamin E supplementation on growth performance, blood biochemical indices, and jejunum morphology in broiler chickens. Materials and methods: A total of 360 one-day-old male Ross 308 broiler chicks were randomly allocated in a completely randomized design with a 3×2 factorial arrangement. These factors included three levels of hydroalcoholic tarragon extract (0, 200, and 400 mg/kg diet) and two levels of vitamin E (0 and 100 mg/kg diet), resulting in six experimental treatments. Each treatment comprised five replicates, with 12 birds per replicate. The birds were fed three dietary phases: starter (days 0-10), grower (days 11-24), and finisher (days 25-42). Throughout the trial, body weight, feed intake, and feed conversion ratio (FCR) were recorded. At the end of the 42-day trial, two birds per replicate were euthanized for sample collection. Blood samples were obtained for biochemical analysis, and the relative weights of carcass components (e.g., liver, gizzard, and abdominal fat) were measured. Additionally, intestinal tissue samples (jejunum) were collected for morphological assessment. Data were analyzed using the general linear model (GLM) procedure in SAS (version 9.4). Significant differences between treatment means were determined using the Tukey-Kramer test at a 5% probability level (P<0.05). Results and discussion: The analysis revealed that the inclusion of 400 mg/kg hydroalcoholic tarragon extract without vitamin E significantly increased feed intake and FCR while reducing body weight compared to the control and the treatment containing 100 mg/kg vitamin E (P<0.05). Birds fed a diet supplemented with 400 mg/kg tarragon extract combined with 100 mg/kg vitamin E exhibited lower abdominal fat content and higher relative weights of the bursa of Fabricius and spleen compared to the control group (P<0.05). Morphological assessment of the jejunum demonstrated enhanced villus height, villus height-to-crypt depth ratio, and absorptive surface area in chickens receiving the 400 mg/kg tarragon extract and 100 mg/kg vitamin E diet compared to the control group (P<0.05). Furthermore, serum biochemical indices revealed that the control group had significantly higher concentration of cholesterol, triglycerides, low-density lipoprotein (LDL), and aspartate aminotransferase (AST) compared to the treatment group supplemented with 400 mg/kg tarragon extract and 100 mg/kg vitamin E (P<0.05). Conclusions: The findings of the present study indicate that supplementing diets with 400 mg/kg hydroalcoholic tarragon extract alone exerts adverse effects on growth performance indices. However, the combined supplementation of 400 mg/kg tarragon extract and 100 mg/kg vitamin E demonstrates synergistic benefits, including enhanced growth performance, intestinal morphology, reduced blood lipid profiles (cholesterol, triglycerides, and LDL) in broiler chickens. Introduction: Production of high-quality protein and white meat products is of paramount importance. To achieve this, the researchers and producers have focused on utilizing growth-promoting compounds and immune system enhancers. These include antibiotics, acidifiers, probiotics, and herbal extracts compounds, which influence gastrointestinal motility, digestive secretions, and transit rate of digesta, gut microbial populations, and intestinal epithelial cell proliferation. Such mechanisms enhance digestive efficiency, nutrient absorption, and ultimately improve growth performance and immune responses in poultry. Among bioactive herbal compounds, tarragon (Artemisia dracunculus) is notable for its rich content of phenolic compounds, carotenoids, coumarins, tannins, and vitamins. Therefore, an experiment was designed to evaluate the effects of hydroalcoholic tarragon extract and vitamin E supplementation on growth performance, blood biochemical indices, and jejunum morphology in broiler chickens. Materials and methods: A total of 360 one-day-old male Ross 308 broiler chicks were randomly allocated in a completely randomized design with a 3×2 factorial arrangement. These factors included three levels of hydroalcoholic tarragon extract (0, 200, and 400 mg/kg diet) and two levels of vitamin E (0 and 100 mg/kg diet), resulting in six experimental treatments. Each treatment comprised five replicates, with 12 birds per replicate. The birds were fed three dietary phases: starter (days 0-10), grower (days 11-24), and finisher (days 25-42). Throughout the trial, body weight, feed intake, and feed conversion ratio (FCR) were recorded. At the end of the 42-day trial, two birds per replicate were euthanized for sample collection. Blood samples were obtained for biochemical analysis, and the relative weights of carcass components (e.g., liver, gizzard, and abdominal fat) were measured. Additionally, intestinal tissue samples (jejunum) were collected for morphological assessment. Data were analyzed using the general linear model (GLM) procedure in SAS (version 9.4). Significant differences between treatment means were determined using the Tukey-Kramer test at a 5% probability level (P<0.05). Results and discussion: The analysis revealed that the inclusion of 400 mg/kg hydroalcoholic tarragon extract without vitamin E significantly increased feed intake and FCR while reducing body weight compared to the control and the treatment containing 100 mg/kg vitamin E (P<0.05). Birds fed a diet supplemented with 400 mg/kg tarragon extract combined with 100 mg/kg vitamin E exhibited lower abdominal fat content and higher relative weights of the bursa of Fabricius and spleen compared to the control group (P<0.05). Morphological assessment of the jejunum demonstrated enhanced villus height, villus height-to-crypt depth ratio, and absorptive surface area in chickens receiving the 400 mg/kg tarragon extract and 100 mg/kg vitamin E diet compared to the control group (P<0.05). Furthermore, serum biochemical indices revealed that the control group had significantly higher concentration of cholesterol, triglycerides, low-density lipoprotein (LDL), and aspartate aminotransferase (AST) compared to the treatment group supplemented with 400 mg/kg tarragon extract and 100 mg/kg vitamin E (P<0.05). Conclusions: The findings of the present study indicate that supplementing diets with 400 mg/kg hydroalcoholic tarragon extract alone exerts adverse effects on growth performance indices. However, the combined supplementation of 400 mg/kg tarragon extract and 100 mg/kg vitamin E demonstrates synergistic benefits, including enhanced growth performance, intestinal morphology, reduced blood lipid profiles (cholesterol, triglycerides, and LDL) in broiler chickens.

https://ar.guilan.ac.ir/article_9229_c4e22959e377de817728e8d10b29e918.pdf

University of Guilan Animal Production Research 2252-0872 15 1 2026 03 21 Effect of broiler raw feather processing on ruminal degradability parameters and digestibility index in AFRC and NorFor systems Effect of broiler raw feather processing on ruminal degradability parameters and digestibility index in AFRC and NorFor systems 71 88 8773 10.22124/ar.2025.29573.1878 FA H. Nouri Department of Animal and Poultry Nutrition, Animal Sciences Faculty, Sari Agricultural and Natural Resources University, Sari, Iran A. Teimouri Yansari Department of Animal and Poultry Nutrition, Animal Sciences Faculty, Sari Agricultural and Natural Resources University, Sari, Iran Y. Chashnidel Department of Animal and Poultry Nutrition, Animal Sciences Faculty, Sari Agricultural and Natural Resources University, Sari, Iran Journal Article 2025 01 15 Introduction: Rising prices for common protein supplements and the limitation of protein sources and as a result, the increase in production costs have created interest in new and cheaper protein sources for livestock. Livestock and poultry industries produce large amounts of protein by-products that can be processed for ruminant feed. Among animal by-products, feathers are produced as a waste by-product in large quantities in poultry slaughterhouses. Unprocessed feather has a low digestibility of about 5.8%, so it needs to be processed as a source of protein. Steam hydrolysis is the most common processing method used in the industry to convert raw feathers into feather meal. Feather processing in Iran is usually done at a pressure of 200 to 300 kPa. Due to the type of processing, feathers are not processed well. In this way, processing at different temperatures and using chemical reducing agents along with proteases during processing to improve the quality of the final product is an option that deserves further investigation. Therefore, the present study aimed to determine the effect of broiler raw feather processing on dry matter and crude protein ruminal degradability. Materials and methods: This research was carried out in a 2×2×2 factorial arrangement based on a completely randomized design with eight treatments and five replications including: 1) Raw feathers autoclaved at 120°C and 2 kPa pressure for 20 minutes, 2) Raw feathers autoclaved at 120°C and 2 kPa pressure for 20 minutes with 0.25% sodium metabisulfite, 3) Raw feathers autoclaved at 120°C and 2 kPa pressure with 0.15% protease enzyme, 4) Raw feathers autoclaved 120°C and 2 kPa pressure for 20 minutes with 0.25% sodium metabisulfite and 0.15% of protease enzyme, 5) Raw feathers autoclaved at 100°C and 2 kPa pressure for 20 minutes, 6) Raw feathers autoclaved at 100°C and 2 kPa pressure for 20 minutes with 0.25% sodium metabisulfite, 7) Raw feathers autoclaved at 100°C and 2 kPa pressure with 0.15% protease enzyme, 8) Raw feathers autoclaved at 100°C and 2 kPa pressure for 20 minutes with 0.25% sodium metabisulfite and 0.15% of protease enzyme. Protein fractions were determined using the Agricultural and Food Research Council equations, as well as degradability parameters using the NorFor method. Ruminal degradability and effective degradability parameters of dry matter and crude protein were determined by rumen incubation at different incubation times inside the rumen of three Zel sheep with rumen fistula. Results and discussion: The study of dry matter degradability data shows that there was a statistically significant difference between the rapidly degradable and the potentially degradable fractions, as well as the constant rate (P>0.05), however, there was no statistically significant difference among the slowly degradable fractions. The effective degradability was statistically significant at the rate of 2, 5, and 8% per hour in the experimental treatments (P>0.05). The results of the ruminal degradability of crude protein showed that there was a statistically significant difference between the rapidly degradable and potentially degradable fractions, as well as the constant rate of crude protein degradation (P>0.05), however, there was no statistically significant difference among the slowly degradable fractions. The effective degradability of crude protein was statistically significant at the passage rate of 2, 5, and 8% per hour in experimental treatments (P>0.05). So that, the raw feathers processing increased the rapidly degradable fraction, the potentially degradable fraction, the constant rate of dry matter, and crude protein degradation, and also the effective degradability at the passage rates of 2, 5, and 8% per hour. Conclusions: According to the results of this research, it can be seen that the use of sodium metabisulfite for the processing of raw feathers increased the rapidly degradable, potentially degradable fraction, and the constant rate, and also the effective degradability in the passage rate of 2 and 5% per hour of dry matter and crude protein. Also, the processing of raw feathers with protease enzyme increased the rapidly degradable part, potentially degradable fraction, constant rate, and effective degradability in the passage rate of 5 and 8% per hour of dry matter and crude protein. Introduction: Rising prices for common protein supplements and the limitation of protein sources and as a result, the increase in production costs have created interest in new and cheaper protein sources for livestock. Livestock and poultry industries produce large amounts of protein by-products that can be processed for ruminant feed. Among animal by-products, feathers are produced as a waste by-product in large quantities in poultry slaughterhouses. Unprocessed feather has a low digestibility of about 5.8%, so it needs to be processed as a source of protein. Steam hydrolysis is the most common processing method used in the industry to convert raw feathers into feather meal. Feather processing in Iran is usually done at a pressure of 200 to 300 kPa. Due to the type of processing, feathers are not processed well. In this way, processing at different temperatures and using chemical reducing agents along with proteases during processing to improve the quality of the final product is an option that deserves further investigation. Therefore, the present study aimed to determine the effect of broiler raw feather processing on dry matter and crude protein ruminal degradability. Materials and methods: This research was carried out in a 2×2×2 factorial arrangement based on a completely randomized design with eight treatments and five replications including: 1) Raw feathers autoclaved at 120°C and 2 kPa pressure for 20 minutes, 2) Raw feathers autoclaved at 120°C and 2 kPa pressure for 20 minutes with 0.25% sodium metabisulfite, 3) Raw feathers autoclaved at 120°C and 2 kPa pressure with 0.15% protease enzyme, 4) Raw feathers autoclaved 120°C and 2 kPa pressure for 20 minutes with 0.25% sodium metabisulfite and 0.15% of protease enzyme, 5) Raw feathers autoclaved at 100°C and 2 kPa pressure for 20 minutes, 6) Raw feathers autoclaved at 100°C and 2 kPa pressure for 20 minutes with 0.25% sodium metabisulfite, 7) Raw feathers autoclaved at 100°C and 2 kPa pressure with 0.15% protease enzyme, 8) Raw feathers autoclaved at 100°C and 2 kPa pressure for 20 minutes with 0.25% sodium metabisulfite and 0.15% of protease enzyme. Protein fractions were determined using the Agricultural and Food Research Council equations, as well as degradability parameters using the NorFor method. Ruminal degradability and effective degradability parameters of dry matter and crude protein were determined by rumen incubation at different incubation times inside the rumen of three Zel sheep with rumen fistula. Results and discussion: The study of dry matter degradability data shows that there was a statistically significant difference between the rapidly degradable and the potentially degradable fractions, as well as the constant rate (P>0.05), however, there was no statistically significant difference among the slowly degradable fractions. The effective degradability was statistically significant at the rate of 2, 5, and 8% per hour in the experimental treatments (P>0.05). The results of the ruminal degradability of crude protein showed that there was a statistically significant difference between the rapidly degradable and potentially degradable fractions, as well as the constant rate of crude protein degradation (P>0.05), however, there was no statistically significant difference among the slowly degradable fractions. The effective degradability of crude protein was statistically significant at the passage rate of 2, 5, and 8% per hour in experimental treatments (P>0.05). So that, the raw feathers processing increased the rapidly degradable fraction, the potentially degradable fraction, the constant rate of dry matter, and crude protein degradation, and also the effective degradability at the passage rates of 2, 5, and 8% per hour. Conclusions: According to the results of this research, it can be seen that the use of sodium metabisulfite for the processing of raw feathers increased the rapidly degradable, potentially degradable fraction, and the constant rate, and also the effective degradability in the passage rate of 2 and 5% per hour of dry matter and crude protein. Also, the processing of raw feathers with protease enzyme increased the rapidly degradable part, potentially degradable fraction, constant rate, and effective degradability in the passage rate of 5 and 8% per hour of dry matter and crude protein.

https://ar.guilan.ac.ir/article_8773_6995c84566f18fa5bb3d11f096a517b0.pdf

University of Guilan Animal Production Research 2252-0872 15 1 2026 03 21 Effect of physical form of feed and feed delivery on performance, digestibility and nutritional behavior, and blood and rumen parameters of fattening lambs Effect of physical form of feed and feed delivery on performance, digestibility and nutritional behavior, and blood and rumen parameters of fattening lambs 89 103 9101 10.22124/ar.2025.29970.1885 FA S. Nazari Seresht Animal Science Department, Faculty of Agriculture, Lorestan University, Khorramabad, Iran A. Azarfar Animal Science Department, Faculty of Agriculture, Lorestan University, Khorramabad, Iran A. Fadayifar Animal Science Department, Faculty of Agriculture, Lorestan University, Khorramabad, Iran Y. Beyranvand Animal Science Department, Faculty of Agriculture, Lorestan University, Khorramabad, Iran Journal Article 2025 03 08 Introduction: Although sheep husbandry in Iran has a long history, it is usually practiced in a traditional manner with low productivity. The growing population, increasing demand for red meat, and high costs of feed supply necessitate the use of rations with balanced nutrients, minimal waste, and maximum profitability. Therefore, nutrition management and improving productivity in this sector are of particular importance. Physical processing of feed is one of the key management strategies in this regard and is among the most important factors affecting feed intake and apparent digestibility. Feed processing and particle size modification have been shown to influence animal performance. Pelleting, grinding feed ingredients, and various processing methods applied to cereal grains and other ration components have all been employed to improve nutrient utilization efficiency in ruminant nutrition. This study investigated the effects of physical form and feeding method of diets on growth performance, apparent digestibility, and selected ruminal and blood parameters of fattening lambs. Materials and methods: Twenty-eight Lori-Bakhtiari male lambs, with an average age of approximately three months and an average body weight of 35.8±4.4 kg, were used at the Small Ruminant Research Farm, Faculty of Agriculture, Lorestan University, Iran. The experimental period lasted 75 days, including 15 days of adaptation and 60 days of fattening. Animals were housed individually (150×100×100 cm; length×width×height) in pens equipped with water and feed buckets, and had ad libitum access to feed and water throughout the study. Four experimental diets were designed in a 2×2 factorial arrangement, consisting of two concentrate forms (pelleted and mash) and two feeding methods (total mixed ration and separate feeding). The treatments included: (1) Total mixed ration (TMR) with mash concentrate, (2) Separate feeding of mash concentrate and forage, (3) TMR with pelleted concentrate, and (4) Separate feeding of pelleted concentrate and forage. The diets for both growing and finishing periods were formulated according to NRC (2007) to meet at least the minimum nutrient requirements of the lambs. The concentrate portion of each diet was ground to 3 mm, and pelleted concentrates were processed using a 5 mm die. During the experimental period, diets were fed twice daily at 08:00 and 16:00 h. Feed intake and refusals were recorded throughout the study. Lambs were weighed on day one and subsequently every 20 days before the morning feeding after a 16-hour fasting period. Average daily gain was calculated as the difference between initial and final weights divided by the number of days. Apparent nutrient digestibility was determined using the acid-insoluble ash marker method. On day 28 of the growing phase and day 58 of the finishing phase, ruminal fluid samples were collected three hours after the morning feeding using a stomach tube. To reduce saliva contamination, the first 10–20 mL of the sample was discarded. Data were analyzed using a completely randomized design with the SAS software (version 9.4). Results and discussion: Feeding pelleted concentrate during the growing period increased the digestibility coefficients of ADF and NDF, while in the finishing period, it improved the digestibility of nutrients, dry matter, organic matter, and ADF (P<0.05). Feeding mash concentrate during the finishing period increased blood urea nitrogen, alanine aminotransferase activity, and eating and chewing times, while reducing resting time (P<0.05). Separate feeding of forage and concentrate during both the growing and finishing periods increased feed intake, improved crude fat digestibility, and in the finishing phase, increased ruminal pH and alkaline phosphatase activity. Feeding mixed rations increased NDF digestibility and alkaline phosphatase activity during the growing phase, and improved ADF digestibility during the finishing phase (P<0.05). The interaction between concentrate processing and feeding method significantly affected crude fat digestibility, blood urea nitrogen, and eating activity in the growing period, as well as crude protein and crude fat digestibility in the finishing phase (P<0.05). However, concentrate processing, feeding method, and their interaction had no significant effect on growth performance traits (P>0.05). Overall, the results demonstrated that physical form and feeding method of the diet influenced apparent digestibility, ruminal and blood parameters, and feeding behavior, but had no effect on growth performance. Conclusions: The results of this study indicated that although dry matter intake was higher in the separate feeding of concentrate and forage treatment, feeding a TMR with pelleted concentrate improved apparent nutrient digestibility and some metabolic parameters. These findings suggest that feed efficiency was higher in the TMR with pelleted concentrate treatment, which may be more beneficial for fattening lambs. Furthermore, feeding method significantly influenced ruminal pH during the finishing period and blood alkaline phosphatase activity during both periods, while concentrate physical form affected blood urea nitrogen and alanine aminotransferase activity in the finishing period, warranting further investigation. Introduction: Although sheep husbandry in Iran has a long history, it is usually practiced in a traditional manner with low productivity. The growing population, increasing demand for red meat, and high costs of feed supply necessitate the use of rations with balanced nutrients, minimal waste, and maximum profitability. Therefore, nutrition management and improving productivity in this sector are of particular importance. Physical processing of feed is one of the key management strategies in this regard and is among the most important factors affecting feed intake and apparent digestibility. Feed processing and particle size modification have been shown to influence animal performance. Pelleting, grinding feed ingredients, and various processing methods applied to cereal grains and other ration components have all been employed to improve nutrient utilization efficiency in ruminant nutrition. This study investigated the effects of physical form and feeding method of diets on growth performance, apparent digestibility, and selected ruminal and blood parameters of fattening lambs. Materials and methods: Twenty-eight Lori-Bakhtiari male lambs, with an average age of approximately three months and an average body weight of 35.8±4.4 kg, were used at the Small Ruminant Research Farm, Faculty of Agriculture, Lorestan University, Iran. The experimental period lasted 75 days, including 15 days of adaptation and 60 days of fattening. Animals were housed individually (150×100×100 cm; length×width×height) in pens equipped with water and feed buckets, and had ad libitum access to feed and water throughout the study. Four experimental diets were designed in a 2×2 factorial arrangement, consisting of two concentrate forms (pelleted and mash) and two feeding methods (total mixed ration and separate feeding). The treatments included: (1) Total mixed ration (TMR) with mash concentrate, (2) Separate feeding of mash concentrate and forage, (3) TMR with pelleted concentrate, and (4) Separate feeding of pelleted concentrate and forage. The diets for both growing and finishing periods were formulated according to NRC (2007) to meet at least the minimum nutrient requirements of the lambs. The concentrate portion of each diet was ground to 3 mm, and pelleted concentrates were processed using a 5 mm die. During the experimental period, diets were fed twice daily at 08:00 and 16:00 h. Feed intake and refusals were recorded throughout the study. Lambs were weighed on day one and subsequently every 20 days before the morning feeding after a 16-hour fasting period. Average daily gain was calculated as the difference between initial and final weights divided by the number of days. Apparent nutrient digestibility was determined using the acid-insoluble ash marker method. On day 28 of the growing phase and day 58 of the finishing phase, ruminal fluid samples were collected three hours after the morning feeding using a stomach tube. To reduce saliva contamination, the first 10–20 mL of the sample was discarded. Data were analyzed using a completely randomized design with the SAS software (version 9.4). Results and discussion: Feeding pelleted concentrate during the growing period increased the digestibility coefficients of ADF and NDF, while in the finishing period, it improved the digestibility of nutrients, dry matter, organic matter, and ADF (P<0.05). Feeding mash concentrate during the finishing period increased blood urea nitrogen, alanine aminotransferase activity, and eating and chewing times, while reducing resting time (P<0.05). Separate feeding of forage and concentrate during both the growing and finishing periods increased feed intake, improved crude fat digestibility, and in the finishing phase, increased ruminal pH and alkaline phosphatase activity. Feeding mixed rations increased NDF digestibility and alkaline phosphatase activity during the growing phase, and improved ADF digestibility during the finishing phase (P<0.05). The interaction between concentrate processing and feeding method significantly affected crude fat digestibility, blood urea nitrogen, and eating activity in the growing period, as well as crude protein and crude fat digestibility in the finishing phase (P<0.05). However, concentrate processing, feeding method, and their interaction had no significant effect on growth performance traits (P>0.05). Overall, the results demonstrated that physical form and feeding method of the diet influenced apparent digestibility, ruminal and blood parameters, and feeding behavior, but had no effect on growth performance. Conclusions: The results of this study indicated that although dry matter intake was higher in the separate feeding of concentrate and forage treatment, feeding a TMR with pelleted concentrate improved apparent nutrient digestibility and some metabolic parameters. These findings suggest that feed efficiency was higher in the TMR with pelleted concentrate treatment, which may be more beneficial for fattening lambs. Furthermore, feeding method significantly influenced ruminal pH during the finishing period and blood alkaline phosphatase activity during both periods, while concentrate physical form affected blood urea nitrogen and alanine aminotransferase activity in the finishing period, warranting further investigation.

https://ar.guilan.ac.ir/article_9101_840a2e54bd0624c3f3ddbedd4e8e8f3b.pdf

University of Guilan Animal Production Research 2252-0872 15 1 2026 03 21 Effect of vitamin B complex injection on blood parameters and antioxidant status in fattening calves under transportation stress Effect of vitamin B complex injection on blood parameters and antioxidant status in fattening calves under transportation stress 105 114 9022 10.22124/ar.2025.30907.1903 FA H. Emrani Department of Biotechnology Research Department, Animal Science Research Institute of Iran, Agricultural Research, Education and Extension Organization (AREEO), Karaj, Iran M. Asadi Department of Animal Science, Gorgan University of Agricultural Sciences and Natural Resources, Gorgan, Iran R. Kamali Department of Animal Sciences Research, Agricultural and Natural Resources Research and Education Center of Gorgan, Agricultural Research, Education and Extension Organization (AREEO), Gorgan, Iran M. Hatami Department of Animal Science, Faculty of Agriculture, University of Tabriz, Tabriz, Iran S. Mirhabibi Department of Animal Science, Golpayegan Branch, Islamic Azad University, Golpayegan, Iran A. Teymouri Department of Animal Science, Gorgan University of Agricultural Sciences and Natural Resources, Gorgan, Iran Journal Article 2025 06 07 Introduction: Most calves transported at a young age from dairy farms, making calf transport an important reputational risk for the dairy industry. Transported dairy calves may be non-replacement calves, which are transported either directly to abattoirs or fattening facilities for veal or beef production, or they may be heifer calves that are transported to rearing facilities in preparation for entering the dairy herd. Transport is a recognized stressor for all ages, with young calves being particularly vulnerable to welfare compromise during and after transport. This vulnerability is due to several factors; for example, the fasting that accompanies transport puts young calves at risk of energy depletion, hunger, and hypoglycemia (low blood glucose), particularly because calves have low body fat reserves compared with adult cattle. Additionally, young calves do not display the herding behavior that is commonly seen in adult cattle, making them more difficult to move; this difficulty potentially puts calves at risk of poor handling. In addition to this, young calves are dependent on colostral immunity for protection from infectious disease. If failure of passive transfer occurs, there is a high risk of morbidity and mortality. Unfortunately, failure of passive transfer is common, occurring in an estimated 8 to 42% of dairy calves. Furthermore, commingling of calves during transport, lairage, and at auction markets potentially increases exposure to pathogens and may lead to social stress, which can affect both immunity and pathogen shedding. Therefore, considering the effect of B vitamins in reducing stress, in this study, the effect of vitamin B complex injection on blood parameters and hormone levels as well as antioxidant status in fattening calves under transportation stress was investigated. Materials and methods: For the present study, 20 fattening calves were selected. They were kept in separate boxes (1×1 m2) with a concrete floor covered with straw during the experiment. The calves were fed the same. Water was also provided freely and separately. The experimental treatments included: 1. The first group (control): without vitamin B complex injection and 2. The second group (B complex): 15 mL of vitamin B complex injection. In this study, after 4 h of vitamin B complex injection, the animals were transported at a distance of 494 km during 10 h, and blood samples were taken from the jugular vein of calves to measure blood plasma parameters. Blood plasma parameters including glucose, cholesterol, triglyceride, urea, creatinine, total protein, albumin, globulin, albumin:globulin, insulin, cortisol, alkaline phosphatase, aspartate transaminase, alanine aminotransferase, triiodothyronine, thyroxine, T3:T4, glutathione peroxidase, superoxide dismutase, catalase, malondialdehyde, and total antioxidant status were measured in the blood of calves. Results and discussion: According to the results, in the B complex group, glucose concentration increased significantly after transportation compared to the control group (P<0.05); in contrast, cholesterol concentration decreased significantly after transportation and 24 hours after transportation in the B complex group compared to the control group (P<0.05). Insulin concentration after transportation and thyroxine concentration after transportation and 24 h after transportation significantly increased in the B complex group than in the control group (P<0.05). In contrast, cortisol concentration after transportation and 24 h after transportation in the B complex group compared to the control group showed a significant decrease (P<0.05). Superoxide dismutase and catalase levels showed a significant increase and malondialdehyde concentration showed a significant decrease after transportation and 24 h after transportation in the B complex group than in the control group (P<0.05). Also, the effect of time and the interaction effect of treatment and time were significant on the concentration of some blood parameters of animals (P<0.05). In this study, vitamin B complex injection led to a reduction in hunger stress during transportation of calves due to increased blood glucose levels and improved energy status. Vitamin B complex injection improved antioxidant status in fattening calves under transportation stress, followed by a reduction in blood cortisol levels and adverse effects of stress in animals. Conclusions: According to the results of this study, vitamin B complex injection acts as a valuable supplement that can be used to improve blood parameters and antioxidant status following reduction of stress in fattening calves. Introduction: Most calves transported at a young age from dairy farms, making calf transport an important reputational risk for the dairy industry. Transported dairy calves may be non-replacement calves, which are transported either directly to abattoirs or fattening facilities for veal or beef production, or they may be heifer calves that are transported to rearing facilities in preparation for entering the dairy herd. Transport is a recognized stressor for all ages, with young calves being particularly vulnerable to welfare compromise during and after transport. This vulnerability is due to several factors; for example, the fasting that accompanies transport puts young calves at risk of energy depletion, hunger, and hypoglycemia (low blood glucose), particularly because calves have low body fat reserves compared with adult cattle. Additionally, young calves do not display the herding behavior that is commonly seen in adult cattle, making them more difficult to move; this difficulty potentially puts calves at risk of poor handling. In addition to this, young calves are dependent on colostral immunity for protection from infectious disease. If failure of passive transfer occurs, there is a high risk of morbidity and mortality. Unfortunately, failure of passive transfer is common, occurring in an estimated 8 to 42% of dairy calves. Furthermore, commingling of calves during transport, lairage, and at auction markets potentially increases exposure to pathogens and may lead to social stress, which can affect both immunity and pathogen shedding. Therefore, considering the effect of B vitamins in reducing stress, in this study, the effect of vitamin B complex injection on blood parameters and hormone levels as well as antioxidant status in fattening calves under transportation stress was investigated. Materials and methods: For the present study, 20 fattening calves were selected. They were kept in separate boxes (1×1 m2) with a concrete floor covered with straw during the experiment. The calves were fed the same. Water was also provided freely and separately. The experimental treatments included: 1. The first group (control): without vitamin B complex injection and 2. The second group (B complex): 15 mL of vitamin B complex injection. In this study, after 4 h of vitamin B complex injection, the animals were transported at a distance of 494 km during 10 h, and blood samples were taken from the jugular vein of calves to measure blood plasma parameters. Blood plasma parameters including glucose, cholesterol, triglyceride, urea, creatinine, total protein, albumin, globulin, albumin:globulin, insulin, cortisol, alkaline phosphatase, aspartate transaminase, alanine aminotransferase, triiodothyronine, thyroxine, T3:T4, glutathione peroxidase, superoxide dismutase, catalase, malondialdehyde, and total antioxidant status were measured in the blood of calves. Results and discussion: According to the results, in the B complex group, glucose concentration increased significantly after transportation compared to the control group (P<0.05); in contrast, cholesterol concentration decreased significantly after transportation and 24 hours after transportation in the B complex group compared to the control group (P<0.05). Insulin concentration after transportation and thyroxine concentration after transportation and 24 h after transportation significantly increased in the B complex group than in the control group (P<0.05). In contrast, cortisol concentration after transportation and 24 h after transportation in the B complex group compared to the control group showed a significant decrease (P<0.05). Superoxide dismutase and catalase levels showed a significant increase and malondialdehyde concentration showed a significant decrease after transportation and 24 h after transportation in the B complex group than in the control group (P<0.05). Also, the effect of time and the interaction effect of treatment and time were significant on the concentration of some blood parameters of animals (P<0.05). In this study, vitamin B complex injection led to a reduction in hunger stress during transportation of calves due to increased blood glucose levels and improved energy status. Vitamin B complex injection improved antioxidant status in fattening calves under transportation stress, followed by a reduction in blood cortisol levels and adverse effects of stress in animals. Conclusions: According to the results of this study, vitamin B complex injection acts as a valuable supplement that can be used to improve blood parameters and antioxidant status following reduction of stress in fattening calves.

https://ar.guilan.ac.ir/article_9022_2452f8d5e0fc619bcb0de37fb9d1b264.pdf