https://ar.guilan.ac.ir/ Animal Production Research en daily 1 Sat, 21 Mar 2026 00:00:00 +0330 Sat, 21 Mar 2026 00:00:00 +0330 https://ar.guilan.ac.ir/article_9418.html Introduction: Integrating RNA-seq and microarray data provides an advanced statistical approach to combine heterogeneous transcriptomic datasets. This approach controls technical variations and can model individual variance, thereby improving the sensitivity for identifying differentially expressed genes and enabling integrated biological pathway analysis. In the livestock and poultry breeding programs, improving feed efficiency is a key goal due to its significant economic benefits. Defined as the ratio between feed intake and weight gain or production, feed efficiency is influenced by a combination of genetic, physiological, nutritional, and environmental factors. Understanding the molecular mechanisms underlying feed efficiency variation can lead to targeted breeding strategies in selective breeding. Given the critical role of the intestine as the primary site of feed digestion and absorption, in this study, transcriptomic data from different platforms was integrated to identify genes, regulatory microRNAs, and shared biological pathways associated with feed efficiency in the duodenum of broilers. The findings support the coordinated roles of energy metabolism and gene expression regulation in intestinal feed efficiency and provide a foundation for the development of molecular markers for breeding applications. Materials and methods: RNA-seq and microarray datasets were integrated based on the shared Ensembl ID using the BASE package in R. Batch effects across datasets were corrected using ComBat, followed by cross-platform quantile normalization. Low-expression genes were filtered using the 25th percentile threshold, and differential gene expression analysis was performed with the limma package in R. The genes with ∣logFC∣>1.5| and P<0.05 were considered significant. Gene ontology and pathway enrichment analyses were conducted using DAVID and KEGG. Protein–protein interaction networks were constructed using STRING and visualized in Cytoscape, with hub genes identified using the MCODE and CytoHubba plugins. Additionally, miRNA–mRNA regulatory networks were generated based on predictions from TargetScan and miRDB. Results and discussion: Comparison of the gene expression profile between groups with low and high feed efficiency revealed a total of 918 significantly differentially expressed genes, including 563 downregulated and 355 upregulated genes. Pathway enrichment analysis highlighted the involvement of energy metabolism, lipid metabolism, and immune-related processes in feed efficiency. The phagosome pathway was significantly enriched, with increased expression of IL16 in the group with high feed efficiency, suggesting higher immune and inflammatory activity. In contrast, the tricarboxylic acid (TCA) cycle was among the most enriched pathways, showing higher expression levels in the group with high feed efficiency. Given the high ATP demand of the intestine for digestion, nutrient absorption, and rapid epithelial renewal, enhanced TCA cycle activity reflects more efficient energy production in the group with higher feed efficiency. Furthermore, increased expression of glutathione S-transferase family genes (GSTA2, GSTA3, GSTM1, and GSTM2) in the group with high feed efficiency indicates an improved antioxidant defense system, which may contribute to reduced oxidative stress and enhanced metabolic efficiency. The key genes involved in fatty acid metabolism (ACADL, ACSL5, EHHADH, and FABP1) were enriched in the PPAR signaling pathway, underscoring their roles in lipid oxidation and energy homeostasis. The identification of ACO1 suggests that regulation of energy metabolism extends beyond the TCA cycle and is linked to nitrogen metabolism and protein synthesis. Moreover, ribosomal protein genes, particularly RPS6, along with hub genes associated with oxidative phosphorylation (NDUFAB1, NDUFA12, NDUFA9, NDUFS6, UQCRQ, and COX7C), emphasize the major role of mitochondrial function and the mTOR–ribosome axis in enhancing ATP production efficiency and lean tissue growth. The robustness of these key genes was further supported by ROC analysis, with all identified biomarkers exhibiting AUC values greater than 0.8, highlighting their potential as molecular indicators of feed efficiency. Conclusions: Overall, the findings of this study indicate that feed efficiency is largely influenced by the coordinated regulation of intestinal energy metabolism, mitochondrial function, and antioxidant defense systems. Higher feed efficiency was correlated with an increased activity of the TCA cycle, oxidative phosphorylation, fatty acid oxidation, and the mTOR–ribosome axis, leading to more efficient ATP production and protein synthesis. Concurrently, the upregulation of glutathione S-transferase–related genes in the group with high feed efficiency reflects improved redox balance and reduced metabolic burden, whereas higher immune-related pathway activity in the group with low feed efficiency may indicate greater energy allocation towards inflammatory processes. Collectively, these results indicate mitochondrial integrity and metabolic flexibility as key physiological mechanisms underlying feed efficiency and highlight the identified genes as promising molecular biomarkers in selective breeding and nutrition management. https://ar.guilan.ac.ir/article_9102.html Introduction: MicroRNAs (miRNAs) are short non-coding RNA molecules, typically 18–24 nucleotides in length, that regulate gene expression post-transcriptionally by binding to complementary sequences in target mRNAs. This interaction can lead to mRNA degradation or translational repression. miRNAs play essential roles in various biological processes, including cell growth, differentiation, apoptosis, metabolism, and immune responses. In poultry, miRNAs are particularly important in modulating immune responses to viral infections such as avian influenza. These molecules can either enhance host defense mechanisms or be exploited by viruses to facilitate infection. The discovery of miRNAs has revolutionized our understanding of gene regulatory networks and opened new avenues for research in genomics, bioinformatics, and infectious disease biology. This study aimed to identify and analyze key miRNAs involved in the immune response of chickens to avian influenza, focusing on their predicted interactions with two ribosomal genes of RPS28 and RPL31. Materials and methods: Two ribosomal genes (RPS28 and RPL31) were selected based on prior transcriptomic analysis using microarray data (GSE96837) from the GEO/NCBI database. The reference genome Gallus gallus GRCg6a (GenBank: GCA_000002315.5) was used for bioinformatic analyses. The tools4miRs platform was employed to predict miRNA–mRNA interactions, integrating 10 algorithms including TargetSpy, miRanda, RNAhybrid, TargetScan, DIANA-microT, MicroTar, miRMap, PITA, RNA22, and Guugle. These tools assess binding potential based on parameters such as free energy, seed sequence complementarity, and evolutionary conservation. Identified miRNAs were cross-referenced with the miRBase database to confirm their annotation status. Results and discussion: Eleven miRNAs (gga-miR-1593, gga-miR-1609, gga-miR-194, gga-miR-214, gga-miR-3532-3p, gga-miR-6567-3p, gga-miR-6579-5p, gga-miR-6612-5p, gga-miR-6642-3p, gga-miR-7477-5p, and gga-miR-708-5p) were analyzed for their interactions with RPS28 and RPL31. For RPL31, gga-miR-6642-3p and gga-miR-3532-3p emerged as the strongest candidates, supported by four independent tools and possessing 15 and 12 binding sites, respectively. For RPS28, gga-miR-6567-3p, gga-miR-6642-3p, gga-miR-7477-5p, and gga-miR-6579-5p were confirmed by five tools and had 8-10 binding sites, indicating strong regulatory potential. Comparative analysis revealed that gga-miR-6642-3p had high regulatory potential for both genes, although binding patterns varied due to gene-specific sequence and structural differences. These findings suggest specificity and overlap in miRNA function across biological pathways. Experimental validation is essential to confirm these bioinformatic predictions. Ribosomal gene expression changes have been linked to immune responses and stress tolerance in poultry. During viral outbreaks such as avian influenza, ribosomal gene expression patterns shift, influencing inflammatory and immune responses. Understanding these changes can aid in vaccine development and disease control strategies. Ribosomal genes are vital for protein synthesis and cellular function, directly impacting poultry growth, development, and health. Located in nucleolus organizer regions (NORs), these genes vary in copy number across poultry lines, correlating with phenotypic traits and breeding responses. For example, white and brown laying hens exhibit different ribosomal gene profiles, affecting protein synthesis capacity and physiological development. RPL3L has been identified as a key gene associated with muscle growth and body weight, influencing skeletal muscle proliferation and differentiation. Mutations in this gene may serve as molecular markers for breeding programs. Ribosomal genes also play roles in immune responses. Their expression changes during infections such as avian influenza, offering insights into disease mechanisms and potential therapeutic targets. Microbiota profiling using 16S rRNA sequencing has furthered our understanding of gut health and its impact on poultry nutrition and productivity. Modern technologies like RNA-Seq and bioinformatic network analysis have enhanced our ability to study ribosomal gene function across tissues and developmental stages, contributing to improved breeding and production management. Conclusions: This comprehensive in silico analysis highlights the regulatory potential of specific miRNAs in the immune response of chickens to avian influenza. miRNAs such as gga-miR-214, gga-miR-194, gga-miR-7477-5p, and gga-miR-6642-3p demonstrate strong interactions with RPS28 and RPL31 ribosomal genes, suggesting roles in antiviral defense and cellular regulation. These findings provide a foundation for future experimental validation and may contribute to the development of miRNA-based strategies for enhancing disease resistance and improving poultry health. The integration of network analysis and bioinformatics offers a powerful model for studying miRNA roles in other diseases and species, paving the way for innovative approaches in veterinary medicine and bioelectronics. Further functional studies are recommended to evaluate the efficacy of epigenetic interventions targeting these miRNAs in managing avian influenza infections. https://ar.guilan.ac.ir/article_9025.html Introduction: Quantitative traits are mainly controlled by many genes with additive effects. However, some genes may have a significant impact on the genetic variation of traits, which are so called major genes and alongside genetic markers, and can be utilized in selection programs for economically important traits. The thyroid hormone responsive gene (THRSP) is a protein-coding gene that is predominantly expressed in mammary, adipose, and liver tissues, and its role in lipid metabolism has been demonstrated in some previous studies. Therefore, its expression may influence various performance and reproductive traits in farm animals. In a previous study, polymorphisms of the THRSP gene exon 1 had significant associations with reproductive traits in Markhoz goats. This study was conducted to investigate polymorphisms in exon 2 of the THRSP gene and their association with production and reproductive traits in Markhoz goats, as an endangered breed. Materials and methods: Blood samples were collected from 146 female Markhoz goats at the Markhoz Goat Research Station in Kurdistan Province, Iran. Polymerase chain reactions (PCR) were performed to amplify two fragments of 306 and 414 base pairs from exon 2 of this gene, using two pairs of specific primers as follows: The 306 bp fragment: 5' GTTCACACTCCTATGCCTA 3' (Forward) and 5' TTTATGGCTCATCAAGTCCGA 3' (Reverse); the 414 bp fragment: 5' TCGCTCCTCTCACTAGCTTG 3' (Forward) and 5' GTCTCTGCTCAATAGGCAT 3' (Reverse). Polymorphisms in the amplified fragments were evaluated using single-strand conformation polymorphism (SSCP) analysis and DNA sequencing. The obtained sequences were compared with the goat reference genome (ARS1: GCF_001704415.1). Allelic and genotypic frequencies were calculated using the counting method, and differences between the observed genotypic frequencies and those expected under Hardy-Weinberg equilibrium were assessed using the chi-square test. The association between the observed genotypes and body weights at different ages was analyzed using a general linear model (GLM), while the association between litter size per lambing and the observed genotypes was evaluated using the non-parametric Wilcoxon test. Results and discussion: In the SSCP analysis of the studied fragments, two distinct patterns were observed for the 414 bp fragment and three distinct patterns were observed for the 306 bp fragment. The sequencing results revealed three single-nucleotide polymorphisms (SNPs) including CHR 29. g.17430527 C>T, CHR 29. g.17430290 G>A, and CHR 29. g.17430307 C>T. The polymorphisms identified in this study have not been previously reported in other goat populations and therefore, can be considered as novel mutations of this gene in goats. The analysis of the predicted amino acid sequences and their comparison with the polypeptide sequence encoded by the reference sequence XM_005699494.3 in GenBank and the goat THRSP sequence in the Ensembl database (ENSCHIG00040005633) revealed that, although the mutations identified in this study were located in exon 2 of THRSP, none of them were present in the final polypeptide product of this gene (sequence XP_005699551.2 in the NCBI database). None of the detected polymorphisms had a significant association with body weight or litter size traits. Non-significant effects of these mutations on the studied production and reproductive traits is likely due to absence of their influence on the amino acid sequence of the final polypeptide product. The observed genotype frequencies at CHR 29. g.17430527 C>T and CHR 29. g.17430290 G>A loci deviated from the Hardy-Weinberg equilibrium. Such deviations may be attributed to sampling effects or genetic drift resulting from the small population size of Markhoz goats. However, it is also possible that these mutations influence RNA splicing process or gene expression, which requires further investigation. Conclusions: In this study, three single-nucleotide polymorphisms of CHR 29. g.17430527 C>T, CHR 29. g.17430290 G>A and CHR 29. g.17430307 C>T.  were identified in exon 2 of the THRSP gene in Markhoz goats, none of which were significantly associated with body weight or litter size traits. It seems that further studies on other major genes in this breed are necessary to identify polymorphisms associated with production and reproductive traits to identify potential markers to use in selection programs. Moreover, it is recommended that similar studies should be conducted on other breeds with larger effective population sizes. https://ar.guilan.ac.ir/article_9229.html Introduction: Production of high-quality protein and white meat products is of paramount importance. To achieve this, the researchers and producers have focused on utilizing growth-promoting compounds and immune system enhancers. These include antibiotics, acidifiers, probiotics, and herbal extracts compounds, which influence gastrointestinal motility, digestive secretions, and transit rate of digesta, gut microbial populations, and intestinal epithelial cell proliferation. Such mechanisms enhance digestive efficiency, nutrient absorption, and ultimately improve growth performance and immune responses in poultry. Among bioactive herbal compounds, tarragon (Artemisia dracunculus) is notable for its rich content of phenolic compounds, carotenoids, coumarins, tannins, and vitamins. Therefore, an experiment was designed to evaluate the effects of hydroalcoholic tarragon extract and vitamin E supplementation on growth performance, blood biochemical indices, and jejunum morphology in broiler chickens. Materials and methods: A total of 360 one-day-old male Ross 308 broiler chicks were randomly allocated in a completely randomized design with a 3×2 factorial arrangement. These factors included three levels of hydroalcoholic tarragon extract (0, 200, and 400 mg/kg diet) and two levels of vitamin E (0 and 100 mg/kg diet), resulting in six experimental treatments. Each treatment comprised five replicates, with 12 birds per replicate. The birds were fed three dietary phases: starter (days 0-10), grower (days 11-24), and finisher (days 25-42). Throughout the trial, body weight, feed intake, and feed conversion ratio (FCR) were recorded. At the end of the 42-day trial, two birds per replicate were euthanized for sample collection. Blood samples were obtained for biochemical analysis, and the relative weights of carcass components (e.g., liver, gizzard, and abdominal fat) were measured. Additionally, intestinal tissue samples (jejunum) were collected for morphological assessment. Data were analyzed using the general linear model (GLM) procedure in SAS (version 9.4). Significant differences between treatment means were determined using the Tukey-Kramer test at a 5% probability level (P<0.05). Results and discussion: The analysis revealed that the inclusion of 400 mg/kg hydroalcoholic tarragon extract without vitamin E significantly increased feed intake and FCR while reducing body weight compared to the control and the treatment containing 100 mg/kg vitamin E (P<0.05). Birds fed a diet supplemented with 400 mg/kg tarragon extract combined with 100 mg/kg vitamin E exhibited lower abdominal fat content and higher relative weights of the bursa of Fabricius and spleen compared to the control group (P<0.05). Morphological assessment of the jejunum demonstrated enhanced villus height, villus height-to-crypt depth ratio, and absorptive surface area in chickens receiving the 400 mg/kg tarragon extract and 100 mg/kg vitamin E diet compared to the control group (P<0.05). Furthermore, serum biochemical indices revealed that the control group had significantly higher concentration of cholesterol, triglycerides, low-density lipoprotein (LDL), and aspartate aminotransferase (AST) compared to the treatment group supplemented with 400 mg/kg tarragon extract and 100 mg/kg vitamin E (P<0.05). Conclusions: The findings of the present study indicate that supplementing diets with 400 mg/kg hydroalcoholic tarragon extract alone exerts adverse effects on growth performance indices. However, the combined supplementation of 400 mg/kg tarragon extract and 100 mg/kg vitamin E demonstrates synergistic benefits, including enhanced growth performance, intestinal morphology, reduced blood lipid profiles (cholesterol, triglycerides, and LDL) in broiler chickens. https://ar.guilan.ac.ir/article_8773.html Introduction: Rising prices for common protein supplements and the limitation of protein sources and as a result, the increase in production costs have created interest in new and cheaper protein sources for livestock. Livestock and poultry industries produce large amounts of protein by-products that can be processed for ruminant feed. Among animal by-products, feathers are produced as a waste by-product in large quantities in poultry slaughterhouses. Unprocessed feather has a low digestibility of about 5.8%, so it needs to be processed as a source of protein. Steam hydrolysis is the most common processing method used in the industry to convert raw feathers into feather meal. Feather processing in Iran is usually done at a pressure of 200 to 300 kPa. Due to the type of processing, feathers are not processed well. In this way, processing at different temperatures and using chemical reducing agents along with proteases during processing to improve the quality of the final product is an option that deserves further investigation. Therefore, the present study aimed to determine the effect of broiler raw feather processing on dry matter and crude protein ruminal degradability. Materials and methods: This research was carried out in a 2×2×2 factorial arrangement based on a completely randomized design with eight treatments and five replications including: 1) Raw feathers autoclaved at 120°C and 2 kPa pressure for 20 minutes, 2) Raw feathers autoclaved at 120°C and 2 kPa pressure for 20 minutes with 0.25% sodium metabisulfite, 3) Raw feathers autoclaved at 120°C and 2 kPa pressure with 0.15% protease enzyme, 4) Raw feathers autoclaved 120°C and 2 kPa pressure for 20 minutes with 0.25% sodium metabisulfite and 0.15% of protease enzyme, 5) Raw feathers autoclaved at 100°C and 2 kPa pressure for 20 minutes, 6) Raw feathers autoclaved at 100°C and 2 kPa pressure for 20 minutes with 0.25% sodium metabisulfite, 7) Raw feathers autoclaved at 100°C and 2 kPa pressure with 0.15% protease enzyme, 8) Raw feathers autoclaved at 100°C and 2 kPa pressure for 20 minutes with 0.25% sodium metabisulfite and 0.15% of protease enzyme. Protein fractions were determined using the Agricultural and Food Research Council equations, as well as degradability parameters using the NorFor method. Ruminal degradability and effective degradability parameters of dry matter and crude protein were determined by rumen incubation at different incubation times inside the rumen of three Zel sheep with rumen fistula. Results and discussion: The study of dry matter degradability data shows that there was a statistically significant difference between the rapidly degradable and the potentially degradable fractions, as well as the constant rate (P>0.05), however, there was no statistically significant difference among the slowly degradable fractions. The effective degradability was statistically significant at the rate of 2, 5, and 8% per hour in the experimental treatments (P>0.05). The results of the ruminal degradability of crude protein showed that there was a statistically significant difference between the rapidly degradable and potentially degradable fractions, as well as the constant rate of crude protein degradation (P>0.05), however, there was no statistically significant difference among the slowly degradable fractions. The effective degradability of crude protein was statistically significant at the passage rate of 2, 5, and 8% per hour in experimental treatments (P>0.05). So that, the raw feathers processing increased the rapidly degradable fraction, the potentially degradable fraction, the constant rate of dry matter, and crude protein degradation, and also the effective degradability at the passage rates of 2, 5, and 8% per hour. Conclusions: According to the results of this research, it can be seen that the use of sodium metabisulfite for the processing of raw feathers increased the rapidly degradable, potentially degradable fraction, and the constant rate, and also the effective degradability in the passage rate of 2 and 5% per hour of dry matter and crude protein. Also, the processing of raw feathers with protease enzyme increased the rapidly degradable part, potentially degradable fraction, constant rate, and effective degradability in the passage rate of 5 and 8% per hour of dry matter and crude protein. https://ar.guilan.ac.ir/article_9101.html Introduction: Although sheep husbandry in Iran has a long history, it is usually practiced in a traditional manner with low productivity. The growing population, increasing demand for red meat, and high costs of feed supply necessitate the use of rations with balanced nutrients, minimal waste, and maximum profitability. Therefore, nutrition management and improving productivity in this sector are of particular importance. Physical processing of feed is one of the key management strategies in this regard and is among the most important factors affecting feed intake and apparent digestibility. Feed processing and particle size modification have been shown to influence animal performance. Pelleting, grinding feed ingredients, and various processing methods applied to cereal grains and other ration components have all been employed to improve nutrient utilization efficiency in ruminant nutrition. This study investigated the effects of physical form and feeding method of diets on growth performance, apparent digestibility, and selected ruminal and blood parameters of fattening lambs. Materials and methods: Twenty-eight Lori-Bakhtiari male lambs, with an average age of approximately three months and an average body weight of 35.8±4.4 kg, were used at the Small Ruminant Research Farm, Faculty of Agriculture, Lorestan University, Iran. The experimental period lasted 75 days, including 15 days of adaptation and 60 days of fattening. Animals were housed individually (150×100×100 cm; length×width×height) in pens equipped with water and feed buckets, and had ad libitum access to feed and water throughout the study. Four experimental diets were designed in a 2×2 factorial arrangement, consisting of two concentrate forms (pelleted and mash) and two feeding methods (total mixed ration and separate feeding). The treatments included: (1) Total mixed ration (TMR) with mash concentrate, (2) Separate feeding of mash concentrate and forage, (3) TMR with pelleted concentrate, and (4) Separate feeding of pelleted concentrate and forage. The diets for both growing and finishing periods were formulated according to NRC (2007) to meet at least the minimum nutrient requirements of the lambs. The concentrate portion of each diet was ground to 3 mm, and pelleted concentrates were processed using a 5 mm die. During the experimental period, diets were fed twice daily at 08:00 and 16:00 h. Feed intake and refusals were recorded throughout the study. Lambs were weighed on day one and subsequently every 20 days before the morning feeding after a 16-hour fasting period. Average daily gain was calculated as the difference between initial and final weights divided by the number of days. Apparent nutrient digestibility was determined using the acid-insoluble ash marker method. On day 28 of the growing phase and day 58 of the finishing phase, ruminal fluid samples were collected three hours after the morning feeding using a stomach tube. To reduce saliva contamination, the first 10–20 mL of the sample was discarded. Data were analyzed using a completely randomized design with the SAS software (version 9.4). Results and discussion: Feeding pelleted concentrate during the growing period increased the digestibility coefficients of ADF and NDF, while in the finishing period, it improved the digestibility of nutrients, dry matter, organic matter, and ADF (P<0.05). Feeding mash concentrate during the finishing period increased blood urea nitrogen, alanine aminotransferase activity, and eating and chewing times, while reducing resting time (P<0.05). Separate feeding of forage and concentrate during both the growing and finishing periods increased feed intake, improved crude fat digestibility, and in the finishing phase, increased ruminal pH and alkaline phosphatase activity. Feeding mixed rations increased NDF digestibility and alkaline phosphatase activity during the growing phase, and improved ADF digestibility during the finishing phase (P<0.05). The interaction between concentrate processing and feeding method significantly affected crude fat digestibility, blood urea nitrogen, and eating activity in the growing period, as well as crude protein and crude fat digestibility in the finishing phase (P<0.05). However, concentrate processing, feeding method, and their interaction had no significant effect on growth performance traits (P>0.05). Overall, the results demonstrated that physical form and feeding method of the diet influenced apparent digestibility, ruminal and blood parameters, and feeding behavior, but had no effect on growth performance. Conclusions: The results of this study indicated that although dry matter intake was higher in the separate feeding of concentrate and forage treatment, feeding a TMR with pelleted concentrate improved apparent nutrient digestibility and some metabolic parameters. These findings suggest that feed efficiency was higher in the TMR with pelleted concentrate treatment, which may be more beneficial for fattening lambs. Furthermore, feeding method significantly influenced ruminal pH during the finishing period and blood alkaline phosphatase activity during both periods, while concentrate physical form affected blood urea nitrogen and alanine aminotransferase activity in the finishing period, warranting further investigation. https://ar.guilan.ac.ir/article_9022.html Introduction: Most calves transported at a young age from dairy farms, making calf transport an important reputational risk for the dairy industry. Transported dairy calves may be non-replacement calves, which are transported either directly to abattoirs or fattening facilities for veal or beef production, or they may be heifer calves that are transported to rearing facilities in preparation for entering the dairy herd. Transport is a recognized stressor for all ages, with young calves being particularly vulnerable to welfare compromise during and after transport. This vulnerability is due to several factors; for example, the fasting that accompanies transport puts young calves at risk of energy depletion, hunger, and hypoglycemia (low blood glucose), particularly because calves have low body fat reserves compared with adult cattle. Additionally, young calves do not display the herding behavior that is commonly seen in adult cattle, making them more difficult to move; this difficulty potentially puts calves at risk of poor handling. In addition to this, young calves are dependent on colostral immunity for protection from infectious disease. If failure of passive transfer occurs, there is a high risk of morbidity and mortality. Unfortunately, failure of passive transfer is common, occurring in an estimated 8 to 42% of dairy calves. Furthermore, commingling of calves during transport, lairage, and at auction markets potentially increases exposure to pathogens and may lead to social stress, which can affect both immunity and pathogen shedding. Therefore, considering the effect of B vitamins in reducing stress, in this study, the effect of vitamin B complex injection on blood parameters and hormone levels as well as antioxidant status in fattening calves under transportation stress was investigated. Materials and methods: For the present study, 20 fattening calves were selected. They were kept in separate boxes (1×1 m2) with a concrete floor covered with straw during the experiment. The calves were fed the same. Water was also provided freely and separately. The experimental treatments included: 1. The first group (control): without vitamin B complex injection and 2. The second group (B complex): 15 mL of vitamin B complex injection. In this study, after 4 h of vitamin B complex injection, the animals were transported at a distance of 494 km during 10 h, and blood samples were taken from the jugular vein of calves to measure blood plasma parameters. Blood plasma parameters including glucose, cholesterol, triglyceride, urea, creatinine, total protein, albumin, globulin, albumin:globulin, insulin, cortisol, alkaline phosphatase, aspartate transaminase, alanine aminotransferase, triiodothyronine, thyroxine, T3:T4, glutathione peroxidase, superoxide dismutase, catalase, malondialdehyde, and total antioxidant status were measured in the blood of calves. Results and discussion: According to the results, in the B complex group, glucose concentration increased significantly after transportation compared to the control group (P<0.05); in contrast, cholesterol concentration decreased significantly after transportation and 24 hours after transportation in the B complex group compared to the control group (P<0.05). Insulin concentration after transportation and thyroxine concentration after transportation and 24 h after transportation significantly increased in the B complex group than in the control group (P<0.05). In contrast, cortisol concentration after transportation and 24 h after transportation in the B complex group compared to the control group showed a significant decrease (P<0.05). Superoxide dismutase and catalase levels showed a significant increase and malondialdehyde concentration showed a significant decrease after transportation and 24 h after transportation in the B complex group than in the control group (P<0.05). Also, the effect of time and the interaction effect of treatment and time were significant on the concentration of some blood parameters of animals (P<0.05). In this study, vitamin B complex injection led to a reduction in hunger stress during transportation of calves due to increased blood glucose levels and improved energy status. Vitamin B complex injection improved antioxidant status in fattening calves under transportation stress, followed by a reduction in blood cortisol levels and adverse effects of stress in animals. Conclusions: According to the results of this study, vitamin B complex injection acts as a valuable supplement that can be used to improve blood parameters and antioxidant status following reduction of stress in fattening calves. https://ar.guilan.ac.ir/article_9024.html Introduction: With the rising cost of high-energy feed ingredients such as oils and cereals, formulating cost-effective poultry diets while maintaining production performance has become a challenge. One strategy to address this issue is to reduce dietary metabolizable energy (ME) levels and compensate by using feed additives like multi-enzymes and phytogenic compounds. Multi-enzymes can improve nutrient digestibility by degrading anti-nutritional factors like non-starch polysaccharides, thereby enhancing gut function and nutrient absorption. Phytogenic compounds, derived from herbs and spices, are known for their antimicrobial, antioxidant, and digestive stimulant properties. However, their efficacy in low-energy diets remains underexplored. Therefore, this study was conducted to evaluate the individual and combined effects of multi-enzymes and a phytogenic compound on the performance, nutrient digestibility, and egg quality of laying hens fed reduced-energy diets.Materials and Methods: A total of 320 Hy-Line W-36 laying hens, aged 70 weeks, were randomly allocated to eight dietary treatments in a 2 × 2 × 2 factorial arrangements with eight replicates of five birds each, and the trial lasted until 78 weeks of age. The experimental factors included two levels of dietary metabolizable energy (2800 and 2650 kcal/kg), presence or absence of multi-enzyme supplementation (200 g/ton), and presence or absence of a standardized phytogenic compound (0.02%). The eight treatments were: (1) control diet (2800 kcal/kg), (2) control + enzyme, (3) control + phytogenic compound, (4) control + enzyme + phytogenic compound, (5) reduced-energy diet (2650 kcal/kg), (6) reduced-energy + enzyme, (7) reduced-energy + phytogenic compound, and (8) reduced-energy + enzyme + phytogenic compound. Data were collected on feed intake, egg production, egg weight, feed conversion ratio, mortality, nutrient digestibility (using acid insoluble ash marker), and egg quality traits including yolk color, shell strength, and Haugh unit.Results and Discussion: Hens fed the control diet (2800 kcal/kg) exhibited significantly better (P < 0.05) performance in terms of egg production, egg weight, egg mass, and feed conversion ratio compared to those receiving the reduced-energy diet (2650 kcal/kg). However, the addition of multi-enzymes and phytogenic compounds to the reduced-energy diet significantly improved these parameters. Notably, hens fed the reduced-energy diet supplemented with both enzyme and phytogenic compound had production performance statistically similar to the control group, suggesting that these additives effectively compensated for the energy reduction. Digestibility results showed that enzyme and phytogenic compound supplementation, both alone and in combination, significantly increased (P < 0.05) the digestibility of dry matter, crude protein, crude fiber, and metabolizable energy, particularly in the reduced-energy diets. This enhancement likely stemmed from improved enzyme-substrate interactions, gut morphology, and microbial balance in the gastrointestinal tract. Egg quality traits also benefited from supplementation. Phytogenic compounds improved yolk color due to their natural carotenoid content, and enzyme supplementation contributed to better eggshell strength, possibly by enhancing calcium absorption. A significant three-way interaction among energy level, enzyme, and phytogenic compound was observed for several traits, including egg production, egg mass, FCR, and yolk pigmentation, highlighting a synergistic relationship between these dietary factors.Conclusions: Reducing dietary energy from 2800 to 2650 kcal/kg negatively impacted the performance, nutrient digestibility, and egg quality of laying hens. However, the inclusion of multi-enzymes and phytogenic compounds mitigated these adverse effects. The combination of both additives was particularly effective in enhancing performance, digestibility, and egg quality in hens fed reduced-energy diets, making these additives viable strategies for cost-effective and sustainable poultry production. These findings underscore the potential of integrating enzyme-phytogenic mixtures into layer diets with lower metabolizable energy to maintain optimal productivity without compromising economic efficiency. https://ar.guilan.ac.ir/article_9100.html Introduction: The poultry industry has faced numerous challenges in recent years, many of which relate to litter quality, gut health, and feed efficiency. Various nutritional factors such as energy and protein levels, mineral content, feed physical form, and dietary restrictions significantly influence litter moisture, litter quality, carcass traits, and foot health. Among these, the relationship between feed physical form and litter quality has received relatively little attention, despite its potential link to locomotion problems, carcass defects, and economic losses. Feed processing methods such as mash, crumble, pellet, and extrusion markedly affect the feed’s structure, density, digestibility, viscosity, and digestive characteristics, thereby influencing gut health, microbial populations, nutrient utilization, feed intake, and growth performance. For example, pelleting reduces feed wastage, increases metabolizable energy density, and improves feed conversion ratio, whereas extrusion by applying heat, pressure, and moisture enhances starch and protein digestibility. Litter moisture creates a favorable environment for microbial proliferation and ammonia production, which is a major concern in closed poultry housing systems due to its negative effects on respiratory health. Ammonia emission from litter depends on factors such as pH, moisture, temperature, ventilation, ammonia and uric acid concentration, litter type, stocking density, and bird age. Moreover, feed physical form influences intestinal morphology such as villus height and crypt depth which can improve or impair nutrient absorption. These morphological changes also affect the stability and composition of the gut microbiota, a critical factor in disease prevention and nutrient utilization. Although several studies have investigated the effect of feed physical form on poultry performance, most focus on a single feed form, with limited research on combinations of feed physical forms across different growth phases. Therefore, this study aimed to evaluate the effects of different feed physical forms, including mash, crumble, pellet, and extruded—administered separately or in combination during starter, grower, and finisher phases, on growth performance, intestinal microbiota, intestinal histology, and litter quality in broiler chickens. Materials and methods: 480 one-day-old male broiler chickens of Ross 308 strain with an average weight of 36 gr were used. The chicks were supplied by Navaid Morgh Gilan Company (Rasht, Iran). Before the arrival of the chicks, experimental diets were prepared and distributed in feeding trays, also water was provided in siphon and nipple drinkers. The diets were supplied in four physical forms: mash, crumble, pellet, and extruded. Diets were formulated to meet the nutrient recommendations for Ross 308. At the end of the experiment, chickens were weighed and feed consumption was recorded. Body weight gain (BWG), feed intake (FI), feed conversion ratio (FCR), and mortality weight were calculated for at the end of rearing period. The birds were slaughtered on day 42. To assess the effects of feed physical form on the intestinal microbial flora, the contents of the duodenum, jejunum, and ileum were collected for counting Escherichia coli, Lactobacillus, and total coliforms. On days 21 and 42, the litter of all pens was examined. Litter samples were collected from five areas of the litter in each replication (four samples from corners and one sample from the center) and transferred to laboratory for analysis. To measure litter moisture, approximately 50 gr of litter sample was placed in an oven at 105 °C until a constant weight was reached, and the moisture content was determined by the weight loss method after drying. After slaughter, samples were taken from the duodenum, jejunum, and ileumand were placed in 10% formalin solution. After tissue fixation for 72 h, dehydration was done with increasing concentration of ethanol following xylene treatment. Then, samples were embedded in paraffin and sectioned into 5-6 μm slices. The tissue sections were stained with hematoxylin and eosin (H&E). The distance from the top to the base of the villi was measured as villus length. The width of the villi was reported from the middle of the villi as villus width. The distance between the base of the villi and the end part of the mucous layer was measured as crypt depth. The villus length to the crypt depth ratio and the villus surface area were calculated. The thickness of the lamina propria and muscularis mucosae was also measured. Statistical analysis was performed using SAS software in a completely randomized design with the GLM procedure. Results and discussion: The results showed that feed physical form significantly influenced growth performance (P<0.05). Chicks fed extruded feed throughout the rearing period had the highest feed intake and weight gain, while the lowest intake was in the mash diet group. No significant difference was observed between the extruded-only group and those receiving crumble in the starter and extruded or pellet in later phases for weight gain (P>0.05). Feed form also affected feed conversion ratio (FCR) (P<0.01), with the lowest FCR in chicks fed crumble in starter and extruded in later phases, but not significantly different from the extruded-only group. Mash diet showed the highest FCR. Feed physical form impacted relative weight and length of jejunum and ileum (P<0.05), but not duodenum. The lowest jejunum and ileum weight were in the extruded group. Feed form significantly affected intestinal microbiota composition and litter characteristics including moisture, pH, and bacterial counts (P<0.05). The highest villi height in jejunum was observed in groups fed crumble in starter and extruded in later phases or pellet throughout. Conclusion: Physical form of feed markedly affects broiler growth, nutrient absorption, gut morphology, microbiota, and litter quality. Extruded feed throughout rearing yielded highest weight gain, while combination of crumble starter and extruded later improved FCR without significant difference to extruded-only. Pellet and extruded feeds increased litter moisture compared to mash, potentially raising risks of leg problems. Thus, optimizing feed form along with litter management is crucial for improving performance and bird health. https://ar.guilan.ac.ir/article_9194.html Introduction: Varroa mite is one of the most important parasites in the honey bee colonies and the beekeeping industry all over the world. It causes great economic loss to the beekeeping industry and beekeepers by feeding on the fat body and hemolymph in different developmental stages of the bees and also by the transmission of pathogenic viral agents. In recent years, the application of chemical pesticides has led to the occurrence of mite resistance and contamination of hive products. Plant extracts are considered as a suitable alternative to chemical acaricides for the Varroa mite control. Therefore, the present study aimed to investigate the acaricidal and insecticidal activity of extract of Ferula assa-foetida, Thymus vulgaris, Rheum persicum, Achillea millefolium, and Euphorbia serrata plants against Varroa mite and its host in the honey bee colonies in the climatic conditions of Kurdistan province from 2022 to 2024. Material and Methods: F. assa-foetida, T. vulgaris, R. persicum, A. millefolium, and E. serrata plants were collected from different regions of Kermanshah province in April and June 2022 and then identified. After separating the waste materials, the aerial parts of the studied plants were dehumidified and dried separately in the shade and at room temperature (28 degrees Celsius and relative humidity of 45%) and then using the device Shredder, their aerial organs were crushed and powdered. The extracts of studied plants in this research were extracted using a Soxhlet extractor and absolute ethanol solvent. Then, the chemical compounds of the plants were identified using a gas chromatography device connected to a mass spectrometer (GC-MS). The present study was conducted in the form of a factorial experiment based on a completely random basic design with 12 treatments and five replications. Before conducting the bioassay experiments, the experimental colonies were homogenized in terms of queen age, population (adults and brood), and honey storage. Also, the initial infestation rate of colonies with Varroa mites was evaluated for adult and brood. In the present study, 60 Langstroth colonies were used, which had a sticky white plastic sheet embedded in the bottom of each colony. The experimental colonies were treated with 15 ml of 20and 40% concentrations of the extracts of the mentioned plants at sunset when all the bees were present in the hive. Every 5 days at 10 am, the plastic sheet was removed from the bottom of all the colonies and the number of dead bees and mites on them was counted. After removing the dead bees and mites, a plastic sheet was again placed on the bottom of the colony. In the present study, the effect of acaricidal activity of different concentrations of each plant extract was calculated using the instructions of Allam et al. (2003). In the present study, the effect of the insecticidal activity of different concentrations of each plant extract on the growth rate of the population (adults and brood) was also evaluated. Finally, the data were analyzed using the GLM procedure embedded in the statistical software SAS V. 9.4 M6, and the mean comparisons were done using the least significant difference (LSD) method by this software.Results and discussion: Generally, the results showed that different concentrations of the extracts of all tested plants showed relatively favorable acaricidal activity to control the Varroa mite in the present study. Based on the results of statistical analysis, the concentration of 40% of F. assa-foetida plant extract showed the greatest effect on the mortality percentage of Varroa mites in the studied bee colonies, and its difference is significant compared to other different concentrations of the studied plants extract (p < 0.01). The results of the effect of insecticidal activity of different concentrations of the studied plants extract on bees showed that the mortality percentage of different concentrations of none of the extracts in the experimental treatments was more than eight percent. GC-MS analysis of plant extracts showed that E-1-propenyl sec-butyl disulfide, Z-1-propenyl sec-butyl disulfide, n-propenyl sec-butyl disulfide, Guaiol, and β-pinene in F. assa-foetida were the main chemical constituents.Conclusion: Our finding showed that the mortality percentage of different concentrations of studied plants extract on bees was not more than eight percent in any of the experimental treatments. Therefore, the concentration of 40% of F. assa-foetida plant extract can be suggested as a suitable alternative to synthetic acaricides to control the Varroa mite in honey bee colonies due to its favorable acaricidal activity on mites.Keywords: Varroa mite, Honey bee, Plant extract, Acaricidal activity, Insecticidal activityConflicts of interest: The authors declare no conflicts of interest.Funding: The authors received no specific funding for this work. https://ar.guilan.ac.ir/article_9195.html Introduction: Poultry nutrition accounts for about 60 to 70 percent of poultry farming costs. Therefore, efforts should be made to develop economic poultry production with the help of scientific principles of nutrition. Yeast and yeast derivatives are among the additives recommended for use in poultry diets to improve performance. Yeast cell walls constitute 25 percent of the dry weight of yeast cells and, in addition to their protective role, are also involved in metabolic processes. Yeast cell wall components include mannoproteins, beta-glucan, mannan oligosaccharide, chitin, and N-acetylglucosamine. Beta-glucan, with its helical structure, has the ability to absorb mycotoxins. Yeast cell walls play an important role in improving the health of livestock and poultry by absorbing toxins in their feed. The role of mannan oligosaccharide in preventing the colonization of pathogens in the digestive tract has been proven. With their prebiotic role, oligosaccharides stimulate the growth of beneficial anaerobic bacteria in the digestive tract and indirectly affect the population of pathogens and improve intestinal morphology.Materials and Methods: An experiment was designed to investigate the effect of different levels of yeast cell wall on functional traits and blood parameters. In this experiment, four levels of yeast cell wall (0, 0.5, 1, and 1.5 g/kg) and 360 one-day-old Japanese quails were used. The experiment was conducted in a completely randomized design with 4 treatments and 6 replications. The experiment was conducted in a completely randomized design with 4 treatments and 6 replications. Performance traits including feed intake, weight gain, and feed conversion ratio were measured throughout the experiment. At the end of the experiment, intestinal sampling was performed to examine intestinal tissue, cecal contents were sampled to examine the cecal microbial population, blood sampling was performed to examine blood factors, and carcass weight was measured.Results and discussion: The results of the experiment showed that the consumption of yeast cell wall increased feed intake and improved weight gain of birds at the age of 22 to 35 days and the entire rearing period (P<0.05). It also reduced feed conversion ratio at the age of 22 to 35 days (P<0.05). The population of lactobacilli in the cecum increased under the influence of yeast cell wall consumption and the population of Escherichia coli decreased (P<0.05). The population of coliforms was not affected by the experimental treatments (P>0.05). Carcass components (Percentage of digestive tract weight, weight of breast, thighs, forestomach, gizzard, liver), small intestine length (duodenum, jejunum and ileum) and the length of the cecum, blood parameters (Triglycerides, cholesterol, glucose, HDL and LDL) and serum liver enzymes (Alanine Aminotransferase, Alkaline Phosphatase, Aspartate Aminotransferase) were also not affected by the experimental treatments (P>0.05). Among the histological characteristics of the duodenum and jejunum, villus height and villus height to crypt depth ratio increased under the influence of yeast cell wall consumption (P<0.05). The beneficial effects of yeast cell walls are primarily associated with active immune function due to the presence of beta-glucan and mannan oligosaccharides in yeast products. The use of yeast products in poultry diets has been reported to improve immunity, balance of microbial populations, and development and health of the gastrointestinal tract. In addition, these additives can improve the digestion and absorption of nutrients in the feed. And through this, improve growth and ultimately improve the performance of the bird. Mannan oligosaccharide present in the yeast cell wall has a high ability to bind to pathogenic bacteria and thus exerts prebiotic properties. The balance between pathogenic and beneficial bacteria increases villi length and decreases crypt depth, which are biomarkers for improved intestinal morphology. Improved intestinal morphology can increase the activity of digestive enzymes and ultimately improve digestion. Longer villi indicate a more mature epithelium and increased absorptive function due to an increased absorptive area of the villi. The development of intestinal morphology can reflect the health status of the animal's digestive tract. Higher villi height increases the activity of enzymes secreted from the ends of the villi, resulting in better digestibility.Conclusion: The results of this study showed that the use of levels of 1 and 1.5 g/kg of yeast cell wall improved the cecum microbial population and histological characteristics of the duodenum, although no effect was observed on the overall performance of the birds. https://ar.guilan.ac.ir/article_9296.html Introduction: Livestock nutrition constitutes a significant portion of the total costs in animal husbandry. To improve efficiency, identifying inexpensive feed sources is a fundamental strategy. Considering that the gap between the demand and supply of feed ingredients has substantially increased over recent decades, and that livestock producers face numerous challenges in acquiring feed resources due to drought and rising prices of conventional feedstuffs, there is a growing necessity to utilize cheap alternative feed materials in ruminant diets. Therefore, processing and proper utilization of agricultural by-products and residues as feed for ruminants is indispensable for enhancing livestock production. Legume straws, particularly bean straw, have attracted attention domestically and internationally as an important and economical roughage source in ruminant nutrition. Due to their superior nutrient composition compared to cereal straws, these materials have greater potential for extensive use in animal diets. The production of bean residues in regions where this crop is cultivated is considerable and can supply a portion of the nutritional requirements of livestock. Feeding bean straw to ruminants may offer advantages over certain cereal straws, potentially due to its higher crude protein content and other valuable nutrients. From a nutritional perspective, processed legume straws serve as a source of energy and protein in the diets of fattening livestock, helping to reduce feeding costs and improve animal productive performance. Accordingly, this study was carried out to evaluate the effects of incorporating processed and unprocessed bean straw into diets on growth performance and fattening traits of Farahani lambs.Materials and Methods: Bean straw was processed with urea by ensiling in plastic covers. For every 100 kg of bean residue, 50 kg of water (50%), 3 kg of chemical urea fertilizer (3%), 1 kg of calcium carbonate (1%), and 100 g of sulfur were added. One month after ensiling, dry matter, ether extract, ash, crude protein, and acid detergent fiber and neutral detergent fiber contents of the processed bean straw were determined. In vitro digestibility of samples was also assessed using the gas test method. Subsequently, at a sheep farm in Arak County, 45 lambs aged 4–5 months with similar average weights were randomly assigned to three experimental groups: 1) wheat straw, 2) bean straw, and 3) urea-treated bean straw. The experiment lasted 90 days, during which lambs’ weight gain was measured every 30 days and daily dry matter intake was recorded by collecting feed refusals before morning feeding. Weight gain, feed conversion ratio (FCR) were examined monthly and over the entire fattening period. Data were analyzed using mixed model procedures in SAS software (version 9.1), and treatment means were compared by Duncan’s multiple range test.Results and Discussion: The results showed that urea treatment increased the crude protein content of bean straw by 25.51%, raising it from 8% in untreated straw to 12.1% in urea-treated straw (P < 0.001). Ammoniation significantly decreased neutral detergent fiber and acid detergent fiber contents (P < 0.001). Urea treatment also significantly enhanced dry matter and organic matter digestibility of the treated bean straw compared to untreated samples (P < 0.001). Additionally, ammoniation led to greater gas production (P < 0.001) and increased organic matter digestibility by about 11%, which subsequently raised the metabolizable energy content from 7.29 to 9.1 MJ/kg DM in treated straw (P = 0.008). The feeding trial revealed that inclusion of bean straw increased daily feed intake compared to the control diet, and urea-treated bean straw further improved intake compared to untreated bean straw (P = 0.028). Moreover, daily weight gain in lambs fed urea-treated bean straw was significantly higher than that of control and untreated bean straw groups (P = 0.001), with a correspondingly improved feed conversion ratio (P = 0.001). The calculation of economic indicators and their comparison among the experimental and control groups demonstrated that the inclusion of bean straw and urea-treated bean straw in the lambs’ diet resulted in a reduction in feeding cost per kilogram of weight gain compared to the control group.Conclusion: In summary, ammoniation of bean by-products with urea constitutes a simple and effective method to process and enhance the nutritional value of these residues. This processing technique significantly improves crude protein content and digestibility, enabling greater substitution of these by-products for conventional feeds such as alfalfa, corn silage, and various oilseed meals in ruminant diets. Consequently, it reduces overall feed costs and lowers meat production expenses. https://ar.guilan.ac.ir/article_9328.html Extended abstractIntroduction: Methionine is an essential amino acid that has a vital role in many physiochemical processes in birds. It is the first limiting amino acid in birds fed with corn-soybean diets. A deficiency of methionine can lead to reductions body weight, egg production, egg weight, and egg mass in laying hen. However, some methyl donor compounds such as choline and betaine can partially substitute for methionine in certain reactions and partially compensate for the effects of methionine deficiency. Therefore, the aim of this study was to evaluate the effects of supplementing betaine and choline to diets with reduced methionine levels on production and egg quality, blood indices and blood and egg antioxidant status in laying hens.Material and methods: In this experiment, 315 Bovans strain laying hens were arranged in a completely randomized 3x3 factorial design including three levels of methionine (80, 90, and 100 percent methionine) and three supplements (no supplement, 0.15 percent betaine, and 0.15 percent choline) with 9 treatments and 7 replications and 5 hens for each replication. Following a 10-day adaptation period, the birds were randomly assigned to experimental units after 10 days adaptation. The birds fed with dietary treatments in two periods of 28 days. In the last two days of each period, 4 eggs from each replication were collected to evaluate the egg quality traits, including egg shape index, specific weight, Haugh unit, yolk height, yolk color index, relative weight of yolk, albumen and eggshell, and eggshell thickness. The blood samples were gathered from two birds of each replicate at end of experimental period to determine the biochemical indices. The data were analyzed by SAS software with GLM. Results & Discussion: The results revealed significant interaction between treatments. Birds fed with fed diets containing 100% methionine had the lowest feed conversion ratio (P<0.05) and the highest egg mass compare to those fed diets contained 80% Met, at 32-35 weeks of age (P<0.01). At 36-39 weeks of age, birds fed 100% Met exhibited the highest egg weight (P<0.01). The yolk color index increased in birds fed 100% Met with 0.15% betaine level and the 90% Met with 0.15% choline level, at the end of first and second periods, respectively (P<0.01). Blood cholesterol and triglyceride concentration decreased in birds fed the 90% level without supplementation (P<0.05). Diets containing 100% Met and 15% betaine treatment decreased yolk cholesterol concentration (P<0.01). These results indicate that recommended methionine level is necessary to maintain egg production and egg mass.Conclusion: It is concluded that a 100 % of Met in laying hens is need to maximize the egg production traits. However, adding betaine to a low-methionine diet has a positive effect on egg quality, and choline supplementation may improve antioxidant status in the blood and eggs. https://ar.guilan.ac.ir/article_9419.html IntroductionGrowth traits are quantitative traits controlled by a large number of genes with small effects, each of which has an additive effect on the phenotype. Today, machine learning methods have been used in animal science not only in GWAS but also in other important topics such as image processing, genomic evaluation, and prediction of important traits. Machine learning methods and their algorithms such as deep learning, random forest, support vector machine, and boosting have been introduced into GWAS topics. The advantages of machine learning methods are their high potential and efficiency, especially for large-volume data and estimation of non-additive effects such as dominance and epistasis, as well as the investigation of complex relationships between variables (such as interactions between markers). Therefore, the aim of this study is to use new technologies, such as genome-wide association studies (GWAS) along with artificial intelligence-based methods such as gradient boosting, to identify mutations in loci associated with growth traits in Lori-Bakhtiari sheep. Materials and MethodsFor the present study, blood samples were collected from 132 Lori-Bakhtiari sheep. Genomic DNA was extracted from whole blood using the Cinagene kit (Cinagene Company, Iran). The samples were genotyped using Illumina 50K Ovine SNPChip, which included 51,135 SNP markers. The gbm package in R software was used to implement the GB method. All markers were ranked based on their importance after applying the gradient boosting method based on the best combination of parameters. After identifying these markers, the genes reported within ± 500 kb of the top 50 SNPs were identified using the NCBI and Ensembl databases from the sheep reference genome Oar_v4.0. To explore the biological and functional processes of the identified genes, ontology studies were performed using the DAVID online database. Finally, gene network analyses were performed using Cytoscape software.Results and DiscussionGenetic parameters and birth weight breeding values were estimated in this study. After quality control, a total of 44,796 SNP markers from 122 sheep remained for final analysis. Manhattan plots were drawn for birth weight and genome-wide SNP values using relative influence. The distribution of ranked SNPs (from most important to least important) was shown based on GB analysis. Our results showed that 2,509 SNPs (5/6%) had positive effects and 42,287 SNPs (94/4%) had neutral effects. The results of the investigation of genes reported within or adjacent to the 50 significant SNP markers identified in the present study led to the identification of 32 candidate genes. Gene ontology analysis of the 50 significant SNP markers and 32 candidate genes identified showed significant associations between the identified ontology pathways and biological processes related to weight gain. Among the top 10 SNPs and the genes identified around them using gradient boosting, there are 4 important genes including KANK1, ZNF277, DOCK4, and APOD, which are involved in the biological processes of body weight traits.ConclusionIn this study, The top 10 SNPs were identified and introduced as potential essential SNPs for analysis. 32 candidate genes for birth weight, some of which are introduced for the first time. The results of the present study can provide valuable information for future research to identify genes, precisely determine candidate genomic regions for important economic traits such as birth weight, and better understand biological mechanisms using gradient boosting algorithm in Iranian sheep breeds. https://ar.guilan.ac.ir/article_9480.html Introduction: Over the past decades, a great number of mathematical models have been proposed to model the curve of the lactating dairy animals. There are two kinds of parametric and non-parametric models, among which the three-parameter Wood's gamma incomplete function has been widely used in dairy cows. Based upon the parameters of Wood's model, some lactation characteristics such as peak time, peak yield, and persistency can be calculated. The lactation features could be recognized as economic traits for which genetic selection to be practiced. Prior studies have been heavily focused on using mathematical models to calculate these lactation characteristics based on the mean of test day milk records, while they could be computed for individual quantiles of TDMR. To the best of our knowledge, no research has been undertaken so far regarding the use of quantile regression in modeling the lactation curve of Iranian dairy cows. Based on this, the main objective of the present research was to evaluate some lactation curve characteristics of Iranian dairy cows by applying the quantile regression technique.Materials and methods: The data used in the present study were provided by the Animal Breeding Centre of Iran. The initial data set were merged and edited by SPSS software. The final data set was comprised of test day milk records (TDMR) collected from 984,690 dairy cows distributed in 579 herds from 26 provinces across the country. Total number of TDMR was 15,647,867 obtained from the first five parities of the cows calved during 1995-2021. Initially, TDMR were analysed based upon a fixed linear model fitted for different combinations of parity – calving season (20 combinations). Then, for each combination, least squares means of TDMR over the interval of 4 to 305 days in milk were utilised in Wood’s incomplete gamma function (y=atbe-ct) in a quantile manner. The Wood’s model is a parametric three-parameter (a, b, c) function that has been widely used to mathematically describe the lactation curve. The linearized form of the Wood’s model was fitted to the least square means of TDMR using the Quantreg procedure of SAS software to estimate the parameters over the quantiles of 5 to 95 by step of 5. Based on the estimated Wood’s parameters, lactation characteristics including peak time, peak yield, and persistency were calculated over these quantiles for all combinations of parity – calving season and statistical comparisons among the combination means were carried out by SPSS software. Results and Discussion: The results of the present research indicated that peak time, peak yield as well as persistency of the lactation curve in Iranian dairy cows were not the same over different quantiles of TDMR, parities, and seasons of calving. The findings also revealed that peak yield increased as the quantile of TDMR increased. In contrast, peak time and persistency in the lower quantiles of TDMR were greater than those obtained in the upper quantiles. Over the quantiles of TDMR, minimum (50.92 d) and maximum (93.36 d) of peak time, as well as persistency (6.64 and 7.37) were observed in the cows calved in autumn and started first or third lactation period (P<0.05). Regarding peak yield, cows calved in spring and started the first lactation period had a lower mean (31.84 Kg) while the maximum mean (40.43 Kg) was observed for the cows calved in autumn and started the fourth lactation period (P<0.05). As expected, first parity cows had greater lactation persistency as compared to the other cows. Peak yield was significantly (P<0.0001) correlated with peak time (-0.9520) and persistency (-0.9516), indicating that cows with a lower level of milk yield at peak time are expected to reach peak time later and to have higher persistency after peak time. Conclusions: The findings of the present research indicated that peak time, peak yield, as well as persistency of the lactation curve in Iranian dairy cows varied over the quantiles of test day milk records such that peak time and persistency were greater in the lower quantiles as compared to the upper quantiles. Furthermore, all above mentioned lactation characteristics are not the same over different parities and calving seasons. Based upon the results of this research, it could be suggested that these variations of the lactation characteristics should be taken into account when all records from different parities are to be used in genetic evaluation of Iranian dairy cows, which will be of great importance when test day models are to be utilized for genetic analysis of the lactation curve. https://ar.guilan.ac.ir/article_9506.html Introduction: The eggshell is composed of approximately 95% calcium carbonate, and optimal calcium supply for laying hens is the most important nutritional factor determining eggshell quality. Also, replacing fine limestone with coarse limestone provides a more uniform availability of calcium to the bird due to its longer retention time in the gizzard. Additionally, the inclusion of insoluble fibers in the diet of laying hens appears to have a significant effect on the bioavailability of calcium particles, as insoluble fibers mechanically stimulate the gizzard wall, leading to an increase in its relative weight and functional activity. The objective of this study was to investigate the effects of different sources of insoluble fiber (no fiber, sunflower hulls, rice hulls – each at 4% of the diet) and calcium carbonate particle size (3 and 5 mm) on the productive performance and egg quality of laying hens. Materials and methods: In this experiment, 216 Hy-Line W-80 laying hens, 70–80 weeks of age, were used for 10 weeks (including 2 weeks of adaptation and 8 weeks of data collection) during the late production phase in a cage system. The hens were randomly allocated to 36 experimental units, consisting of 6 treatments and 6 replicates (6 birds per replicate), in a completely randomized design with a 3×2 factorial arrangement. Egg production and egg weight were recorded on a daily basis, while feed intake was recorded weekly. To evaluate egg quality characteristics, two eggs from each replicate were labeled and transferred to the laboratory at the end of the fourth and eighth weeks.Results and discussion: The results showed that there was no significant interaction between fiber source and calcium carbonate particle size on feed intake (P>0.05). However, sunflower hulls significantly increased feed intake (in the first week, second week, and overall: 116.8, 130.9, and 142.2 g; P<0.05). Fine calcium carbonate increased feed intake by 7% in the second week and by 4.5% over the entire period compared with the coarse type. Despite the identical inclusion of an insoluble fiber source in the diets, the differences in feed intake are attributable to the distinct physical characteristics of the fiber sources. Sunflower hulls, due to their coarser structure and greater susceptibility to fragmentation, exert a stronger physiological effect on gizzard activity, which may consequently lead to increased feed intake. Coarse particles of calcium carbonate appear to provide a more stable and effective calcium supply for eggshell formation due to their longer retention time in the gizzard, gradual dissolution, and slow release of calcium. The importance of this phenomenon is greater in older hens, as bone calcium reserves decline with age, increasing the reliance on the gradual release of dietary calcium. Therefore, although fine calcium carbonate particles may increase passage rate and stimulate feed intake, calcium provision from coarse particles is a key factor in maintaining egg production and shell quality in these birds. A fiber-free diet combined with fine calcium carbonate resulted in the lowest egg weight (P<0.05). Sunflower hulls increased egg mass throughout the entire period (57.3 g). Sunflower hulls also led to an increase in feed conversion ratio (1.9 in the first week and 2.19 overall). Eggshell strength and eggshell percentage were higher in the groups receiving coarse calcium carbonate (7% and 5% in the second week and overall, respectively). Given the differences in solubility among calcium carbonate particle sizes, coarse calcium carbonate appears to provide greater calcium availability to hens, thereby resulting in increased eggshell deposition. The highest yolk color score was observed in the diet containing rice hulls and coarse calcium carbonate. The increase in yolk color observed with the use of rice hulls may be attributed to enhanced mechanical activity of the gizzard and a reduced feed passage rate. Similarly, coarse calcium carbonate, due to its longer retention time in the gizzard, exerts a comparable effect. The combination of these two factors improves digestion and increases the bioavailability of lipophilic pigments (xanthophylls), ultimately leading to greater deposition of these pigments in the yolk. Conclusions: The results indicated that the inclusion of 4% insoluble fiber—especially sunflower hulls—improved feed intake, increased egg mass and egg weight, and enhanced eggshell thickness in laying hens, without negatively affecting the rate of lay. Additionally, the use of coarse calcium carbonate improved eggshell quality.