نوع مقاله : مقاله پژوهشی
نویسندگان
1 گروه علوم دامی، دانشکده کشاورزی، دانشگاه بوعلی سینا
2 مرکز تحقیقات ابریشم کشور، سازمان تحقیقات، آموزش و ترویج کشاورزی، گیلان، ایران
چکیده
کلیدواژهها
موضوعات
عنوان مقاله [English]
نویسندگان [English]
Introduction: Quantitative traits are mainly controlled by many genes with additive effects. However, some genes may have a significant impact on the genetic variation of traits, which are so called major genes and alongside genetic markers, and can be utilized in selection programs for economically important traits. The thyroid hormone responsive gene (THRSP) is a protein-coding gene that is predominantly expressed in mammary, adipose, and liver tissues, and its role in lipid metabolism has been demonstrated in some previous studies. Therefore, its expression may influence various performance and reproductive traits in farm animals. In a previous study, polymorphisms of the THRSP gene exon 1 had significant associations with reproductive traits in Markhoz goats. This study was conducted to investigate polymorphisms in exon 2 of the THRSP gene and their association with production and reproductive traits in Markhoz goats, as an endangered breed.
Materials and methods: Blood samples were collected from 146 female Markhoz goats at the Markhoz Goat Research Station in Kurdistan Province, Iran. Polymerase chain reactions (PCR) were performed to amplify two fragments of 306 and 414 base pairs from exon 2 of this gene, using two pairs of specific primers as follows: The 306 bp fragment: 5' GTTCACACTCCTATGCCTA 3' (Forward) and 5' TTTATGGCTCATCAAGTCCGA 3' (Reverse); the 414 bp fragment: 5' TCGCTCCTCTCACTAGCTTG 3' (Forward) and 5' GTCTCTGCTCAATAGGCAT 3' (Reverse). Polymorphisms in the amplified fragments were evaluated using single-strand conformation polymorphism (SSCP) analysis and DNA sequencing. The obtained sequences were compared with the goat reference genome (ARS1: GCF_001704415.1). Allelic and genotypic frequencies were calculated using the counting method, and differences between the observed genotypic frequencies and those expected under Hardy-Weinberg equilibrium were assessed using the chi-square test. The association between the observed genotypes and body weights at different ages was analyzed using a general linear model (GLM), while the association between litter size per lambing and the observed genotypes was evaluated using the non-parametric Wilcoxon test.
Results and discussion: In the SSCP analysis of the studied fragments, two distinct patterns were observed for the 414 bp fragment and three distinct patterns were observed for the 306 bp fragment. The sequencing results revealed three single-nucleotide polymorphisms (SNPs) including CHR 29. g.17430527 C>T, CHR 29. g.17430290 G>A, and CHR 29. g.17430307 C>T. The polymorphisms identified in this study have not been previously reported in other goat populations and therefore, can be considered as novel mutations of this gene in goats. The analysis of the predicted amino acid sequences and their comparison with the polypeptide sequence encoded by the reference sequence XM_005699494.3 in GenBank and the goat THRSP sequence in the Ensembl database (ENSCHIG00040005633) revealed that, although the mutations identified in this study were located in exon 2 of THRSP, none of them were present in the final polypeptide product of this gene (sequence XP_005699551.2 in the NCBI database).
None of the detected polymorphisms had a significant association with body weight or litter size traits. Non-significant effects of these mutations on the studied production and reproductive traits is likely due to absence of their influence on the amino acid sequence of the final polypeptide product. The observed genotype frequencies at CHR 29. g.17430527 C>T and CHR 29. g.17430290 G>A loci deviated from the Hardy-Weinberg equilibrium. Such deviations may be attributed to sampling effects or genetic drift resulting from the small population size of Markhoz goats. However, it is also possible that these mutations influence RNA splicing process or gene expression, which requires further investigation.
Conclusions: In this study, three single-nucleotide polymorphisms of CHR 29. g.17430527 C>T, CHR 29. g.17430290 G>A and CHR 29. g.17430307 C>T. were identified in exon 2 of the THRSP gene in Markhoz goats, none of which were significantly associated with body weight or litter size traits. It seems that further studies on other major genes in this breed are necessary to identify polymorphisms associated with production and reproductive traits to identify potential markers to use in selection programs. Moreover, it is recommended that similar studies should be conducted on other breeds with larger effective population sizes.
کلیدواژهها [English]
)